Gamt (NM_010255) Mouse Untagged Clone

SKU
MC202309
Gamt (untagged) - Mouse guanidinoacetate methyltransferase (Gamt), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Gamt
Synonyms AA571402; Spintz1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC049233 sequence for NM_010255
GGCCCCGCGGCTCCGCAGCCCTGCGCTCCCGGCCTGGTTTGCACAGCCTCACCATGAGCTCTTCTGCAGC TAGCCCGCTCTTCGCGCCCGGCGAGGACTGCGGCCCCGCGTGGCGCGCGGCCCCCGCGGCCTATGACGCG TCTGACACGCACCTGCAAATCCTGGGCAAGCCAGTGATGGAGCGTTGGGAGACCCCCTATATGCATGCGC TAGCGGCGGCTGCTGCCTCCAGAGGGGGCCGGGTCTTGGAAGTGGGCTTCGGTATGGCCATTGCAGCCTC CAGGGTGCAACAGGCCCCCATAGAGGAACACTGGATTATTGAGTGCAATGATGGGGTCTTCCAGCGTCTA CAAGACTGGGCCCTGCGGCAGCCACATAAGGTTGTTCCCTTGAAAGGCCTGTGGGAGGAGGTGGCACCTA CCCTGCCTGACGGTCACTTTGATGGGATTCTATATGACACGTACCCGCTGTCTGAAGAGGCCTGGCACAC TCACCAGTTCAACTTTATTAAGAATCATGCCTTCCGCTTGCTGAAGACCGGGGGCGTCCTCACCTACTGC AACCTCACGTCCTGGGGGGAGCTCATGAAGTCCAAATACACAGACATCACCACCATGTTTGAGGAGACGC AGGTGCCTGCACTGCAGGAAGCTGGCTTCCTGAAAGAAAACATCTGCACAGAGGTGATGGCACTGGTGCC CCCAGCCGACTGCCGCTACTATGCCTTCCCTCAGATGATCACACCCCTGGTCACCAAGCACTGAGCAGCC GGCCCAGGTCTACAAGGAGCCTGTGTCCTCCTCAGTACCTTTGTGGCTGGATTGTGGGCTCCAGCCTCTC CACTGTCCCTCAGTGTGACATCCTAACCTCTGCCTGGCACTGCCATCTTCCCAGAGCTCAGGAGTAAAAT AAATGCTAACAAGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_010255
Insert Size 711 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC049233, AAH49233
RefSeq Size 938 bp
RefSeq ORF 711 bp
Locus ID 14431
UniProt ID O35969
Cytogenetics 10 39.72 cM
Summary Converts guanidinoacetate to creatine, using S-adenosylmethionine as the methyl donor. Important in nervous system development.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the shorter transcript and encodes the shorter isoform (1).
Write Your Own Review
You're reviewing:Gamt (NM_010255) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG202886 Gamt (tGFP-tagged) - Mouse guanidinoacetate methyltransferase (Gamt) 10 ug
$500.00
MR202886 Gamt (Myc-DDK-tagged) - Mouse guanidinoacetate methyltransferase (Gamt) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR202886L3 Lenti ORF clone of Gamt (Myc-DDK-tagged) - Mouse guanidinoacetate methyltransferase (Gamt) 10 ug
$600.00
MR202886L4 Lenti ORF clone of Gamt (mGFP-tagged) - Mouse guanidinoacetate methyltransferase (Gamt) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.