Fabp4 (NM_024406) Mouse Untagged Clone

SKU
MC202250
Fabp4 (untagged) - Mouse fatty acid binding protein 4, adipocyte (Fabp4), (10ug)
  $150.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fabp4
Synonyms 422/aP2; ALBP/Ap2; Ap2; Lbpl
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC054426 sequence for NM_024406
TGCAGCCTTTCTCACCTGGAAGACAGCTCCTCCTCGAAGGTTTACAAAATGTGTGATGCCTTTGTGGGAA CCTGGAAGCTTGTCTCCAGTGAAAACTTCGATGATTACATGAAAGAAGTGGGAGTGGGCTTTGCCACAAG GAAAGTGGCAGGCATGGCCAAGCCCAACATGATCATCAGCGTAAATGGGGATTTGGTCACCATCCGGTCA GAGAGTACTTTTAAAAACACCGAGATTTCCTTCAAACTGGGCGTGGAATTCGATGAAATCACCGCAGACG ACAGGAAGGTGAAGAGCATCATAACCCTAGATGGCGGGGCCCTGGTGCAGGTGCAGAAGTGGGATGGAAA GTCGACCACAATAAAGAGAAAACGAGATGGTGACAAGCTGGTGGTGGAATGTGTTATGAAAGGCGTGACT TCCACAAGAGTTTATGAAAGGGCATGAGCCAAAGGAAGAGGCCTGGATGGAAATTTGCATCAAACACTAC AATAGTCAGTCGGATTTATTGTTTTTTTTTAAAGATATGATTTTCCACTAATAAGCAAGCAATTAATTTT TTCTGAAGATGCATTTTATTGGATATGGTTATGTTGATTAAATAAAACCTTTTTAGACTTAAAAAAAAAA AAAAA
Restriction Sites RsrII-NotI |
ACCN NM_024406
Insert Size 399 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC054426, AAH54426
RefSeq Size 635 bp
RefSeq ORF 399 bp
Locus ID 11770
UniProt ID P04117
Cytogenetics 3 2.56 cM
Summary Lipid transport protein in adipocytes. Binds both long chain fatty acids and retinoic acid. Delivers long-chain fatty acids and retinoic acid to their cognate receptors in the nucleus.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_024406" in other vectors (4)
SKU Description Size Price
MG200762 Fabp4 (tGFP-tagged) - Mouse fatty acid binding protein 4, adipocyte (Fabp4) 10 ug
$350.00
MR200762 Fabp4 (Myc-DDK-tagged) - Mouse fatty acid binding protein 4, adipocyte (Fabp4) 10 ug
$289.00
MR200762L3 Lenti ORF clone of Fabp4 (Myc-DDK-tagged) - Mouse fatty acid binding protein 4, adipocyte (Fabp4) 10 ug
$450.00
MR200762L4 Lenti ORF clone of Fabp4 (mGFP-tagged) - Mouse fatty acid binding protein 4, adipocyte (Fabp4) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products