Psenen (NM_025498) Mouse Untagged Clone

SKU MC202131

Psenen (untagged) - Mouse presenilin enhancer 2 homolog (C. elegans) (Psenen), (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Psenen
• Synonyms: 1700023M09Rik; Pen-2
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC024347 sequence for NM_025498; CGGAGGGGGTGGGGTGCGAGGGGGGCTGGGCAGGAGAAGAAAAAAAAAAGCGACAACAAACTCCACTGAA AACTGCGGCATCTCCCGCAAATCTCCCGCAAAGGAATCCAGGCAGAAGGGATAAACCGCACTGGGGCGTG GTTGCTCGTGATCTTGCGTCTGTCATTTGGGTCTTGCTCTGCAGACCCTTAGGACCACCGGGCTCCAGCG CAACTATGAACTTGGAGCGGGTATCCAATGAGGAGAAGTTGAACCTGTGCCGGAAGTACTATCTTGGTGG ATTTGCGTTCCTGCCTTTTCTTTGGTTAGTCAACATTTTCTGGTTCTTCAGAGAGGCGTTCCTCGCCCCA GCCTACACAGAGCAGAGCCAAATCAAAGGCTATGTTTGGCGCTCAGCTGTGGGCTTCCTCTTCTGGGTGA TCATTCTCGCCACCTGGATCACCATCTTCCAGATCTACCGGCCCCGCTGGGGCGCTCTTGGGGACTACCT CTCCTTCACCATTCCCCTGGGCACTCCCTAACAACTTCATAAGCTGCTGATCTGTTCTTTCTCCCAGGAT GAAGGCTTCTCTGCTCTAGGCTTTCCCTCAGACCCTGAAGACATCTGTTTCTCATTTCCCATCTGCCCCA ATAAAGGACCCTAACTTTAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_025498
• Insert Size: 306 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: BC024347, AAH24347
• RefSeq Size: 670 bp
• RefSeq ORF: 306 bp
• Locus ID: 66340
• UniProt ID: Q9CQR7
• Cytogenetics: 7 B1
• Summary: Essential subunit of the gamma-secretase complex, an endoprotease complex that catalyzes the intramembrane cleavage of integral membrane proteins such as Notch receptors and APP (amyloid-beta precursor protein) (PubMed:12522139, PubMed:24941111). The gamma-secretase complex plays a role in Notch and Wnt signaling cascades and regulation of downstream processes via its role in processing key regulatory proteins, and by regulating cytosolic CTNNB1 levels (Probable). PSENEN modulates both endoproteolysis of presenilin and gamma-secretase activity (PubMed:12522139, PubMed:24941111).[UniProtKB/Swiss-Prot Function]