Prl2c3 (NM_011118) Mouse Untagged Clone

SKU
MC201934
Prl2c3 (untagged) - Mouse prolactin family 2, subfamily c, member 3 (Prl2c3), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Prl2c3
Synonyms Ghd1; MRP-2; MRP-3; mrp/plf3; Mrpplf3; PLF-2; PLF-3; Plf2; Prl2c4
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC064771 sequence for NM_011118
TCCCTCCAGTGAAGCATCTTCCCGGAATCCACAGCTAAGCCTGGGTAGGACTCTGCAGAGATGCTCCCTT CTTTGATTCAACCATGCTCCTGGATACTGCTCCTACTACCGGTGAACAGCTCGTTATTGTGGAAGAATGT TGCCTCATTTCCCATGTGTGCAATGAGGAATGGTCGTTGCTTTATGTCCTTTGAAGACACATTTGAATTA GCCGGCAGTTTGTCTCATAATATCAGTATAGAAGTTTCAGAACTGTTCACTGAATCTGAAAAACATTATT CTAACGTGTCTGGGCTCAGAGACAAAAGCCCCATGAGATGCAATACTTCTTTCCTTCCAACTCCAGAAAA CAAGGAACAAGCCAGGCTCACACACTATTCAGCTCTTCTGAAATCAGGAGCCATGATTTTGGATGCCTGG GAAAGCCCTCTGGACGATCTAGTGAGTGAATTATCTACCATAAAAAATGTCCCTGATATAATCATCTCCA AAGCCACAGACATAAAGAAAAAGATCAACGCAGTCCGGAACGGGGTTAATGCCCTCATGAGCACCATGCT TCAGAATGGAGATGAAGAAAAGAAGAACCCTGCCTGGTTCTTGCAATCTGACAATGAAGATGCTCGCATT CATTCTTTATATGGCATGATCAGCTGCCTAGACAATGACTTTAAGAAGGTTGATATTTATCTCAACGTCC TGAAGTGTTACATGTTAAAAATAGATAACTGCTGATATTTCTTTCATGTGCTCTGCTTCTGAAATATCAT GTAATATCCTTTCAATTTGTATCTTTTGAATTTGTTGTTGACTCATTTAAAAATAAAAAGTAGCTCTCAG AAATAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_011118
Insert Size 675 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC064771, AAH64771
RefSeq Size 861 bp
RefSeq ORF 675 bp
Locus ID 18812
UniProt ID P04768
Cytogenetics 13 A1
Write Your Own Review
You're reviewing:Prl2c3 (NM_011118) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG202608 Prl2c3 (tGFP-tagged) - Mouse proliferin 2 (Plf2) 10 ug
$500.00
MR202608 Prl2c3 (Myc-DDK-tagged) - Mouse prolactin family 2, subfamily c, member 3 (Prl2c3) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR202608L3 Lenti ORF clone of Prl2c3 (Myc-DDK-tagged) - Mouse prolactin family 2, subfamily c, member 3 (Prl2c3) 10 ug
$600.00
MR202608L4 Lenti ORF clone of Prl2c3 (mGFP-tagged) - Mouse prolactin family 2, subfamily c, member 3 (Prl2c3) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.