Lrrc26 (NM_146117) Mouse Untagged Clone

SKU
MC201791
Lrrc26 (untagged) - Mouse leucine rich repeat containing 26 (Lrrc26), (10ug)
$450.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Lrrc26
Synonyms RP23-132N23.19
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC024539 sequence for NM_146117
GACGGCTTTGGGGCACCTTGACTCCAAAGCCCGAAGCCGCACATGCGGGGTTCTTTTTTCTCGCGGCTTC CGCCGCAACTCTCTCTGCTGCTGCTGCTGTCGTTGAGGCGAGTCTGGACCCAGGAGGATATTGGAACTGC CCCTTCTAAATCCCCGGTGGCCCCCGAATGCCCCGAGGCATGTTCATGTTCACTAGGCGGCAAGGCCAAT TGCTCCGCACTCGCGCTGCCTGCGGTACCAGCGGACCTGAGCTGGCAAGTACGCTCACTGCTGCTGGATC ACAATCGCGTGAGCGCGCTGCCTCCGGGTGCCTTCGCCAATGCAGGCGCGCTGCTATACCTAGATCTGAG GGAGAACCGGCTTCGGTCGGTGCACGCACGAGCTTTCTGGGGTCTGGGAGTGTTGCAATGGCTGGACCTG AGCTCCAACCAGCTGGAAACTCTGCCTCCTGGCACCTTCGCGCCGCTGCGCGCGCTTAGTTTCCTCTCCC TAGCGGGTAACCGGCTGGCACTCCTGGAGCCTTCGATCCTGGGCCCGCTTCCATTACTGCGAGTGCTCAG CCTGCAGGACAATTCACTATCGGCAATCGAGGCGGGTTTGCTGAATAACTTGCCTGCCCTCGATGTGTTG CGCTTGCATGGCAACCCCTGGACGTGCAACTGTGCGCTGCGTCCCCTTTGCACTTGGCTGCGTAAGCACC CGCGTCCAGCCTCAGAAACTGAGACCCTGCTCTGCGTGTCTCCAAGACTCCAGACGCTCAGCCTACTGAC AGCTTTTCCGGATGCCGCCTTCAAACAGTGCACTCAGTCACTAGCAGCGCGAGACCTGGCGGTGGTCTAC GCTCTCGGGCCGGTCTCTTTCCTTGCTAGTTTGGCCATCTGCCTGGCATTGGGCTCCGTGCTCACTGCTT GTGGTGCACGGCGCCGCCGCCGCCGCCGCACCACGGTGCGCCACTTACTAAGGAGACAGCTAGACCCCGA GGGCCCACCCTCCCTGGAGGATGCTGGGAGCCCTGTAACAGCAGCTATCCAAGCCTAAGGGGACTGCAGG TTGTTTCTAGTGCTCCTGAAGTGCCTCCGTACTTTGAGAACTCTCCCCAAATCCCTGATCCTCCCTTCAC ATTCCCTGTAGGCGTCAACAATAGACAAAACCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_146117
Insert Size 996 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC024539, AAH24539
RefSeq Size 1224 bp
RefSeq ORF 996 bp
Locus ID 227618
UniProt ID Q91W20
Cytogenetics 2 A3
Summary Auxiliary protein of the large-conductance, voltage and calcium-activated potassium channel (BK alpha). Required for the conversion of BK alpha channels from a high-voltage to a low-voltage activated channel type in non-excitable cells. These are characterized by negative membrane voltages and constant low levels of calcium (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Lrrc26 (NM_146117) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204872 Lrrc26 (tGFP-tagged) - Mouse cDNA sequence BC004853 (BC004853) 10 ug
$650.00
MR204872 Lrrc26 (Myc-DDK-tagged) - Mouse leucine rich repeat containing 26 (Lrrc26) 10 ug
$450.00
MR204872L3 Lenti ORF clone of Lrrc26 (Myc-DDK-tagged) - Mouse leucine rich repeat containing 26 (Lrrc26) 10 ug
$750.00
MR204872L4 Lenti ORF clone of Lrrc26 (mGFP-tagged) - Mouse leucine rich repeat containing 26 (Lrrc26) 10 ug
$750.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.