Nmral1 (NM_026393) Mouse Untagged Clone

SKU
MC201364
Nmral1 (untagged) - Mouse NmrA-like family domain containing 1 (Nmral1), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Nmral1
Synonyms 1110025F24Rik; AI256624
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC030039 sequence for NM_026393
GGGTATTGCCAGACAGAATCTCGGGACGCGTTCAGGGACCGGACGTCTCAGGGTAGAGATTCTGCCCTTC GCCAACTCTGCCACCCCAGGCCTCTTTGGATCACGCTCTTTGGGCTCTGGACCCCATGGCTGATAGGAAA CTGGTGGTGGTTTTTGGAGCCACAGGTGCGCAAGGTGGCTCTGTGGCCCGTGCATTGCTAGAAGATGGGA CATTCAGGATTCGAGTGGTAACAAGAAACCCTGAGCAGAGGGCAGCCAAAGAGCTGAAGCAGCAAGGTGC TGAGGTAGTGCGAGGAGACCAGGACGATGCAGCTAGCATGGAGCTGGCCTTGGCTGGAGCCCATGCCACC TTCATTGTGACCAATTACTGGGAGACGTGCAGCCAGGACCGAGAAGTGCAGCAGCCCCACCAGTGGGACC AAGTATTCAAACAAGGCAAGCTTCTAGCCGATCTAGCCAAACGCTTGGGCCTCCATTATGTAGTGTACAG TGGCCTGGAGAACATCAGGAAGCTGACGGCTGGGAAGCTGGCCGCAGGACACTTTGATGGCAAAGGGGAG GTGGAGGAATACTTCCGAGACATCGGTGTTCCCATGACCAGTGTGCGGCTGCCTTGCTATTTCGAGAATC TCCTTTCCTATTTCCTGCCCCAGAAAGCTGCAGATGGAAAAAGCTTCTTGCTGGACTTGCCCATGGGTGA CGTCCCCATGGATGGAATGTCTGTGAGTGACCTGGGCCCCGTGGTGCTCAGCTTGCTGAAGAAGCCAGAA GAGTACGTAGGGCAGAACATCGGGCTCAGTACCTGCAGGCACACCGCAGAGGAGTATGCTGCCTTGCTTA GCAAGCACACTGGCAAGGCTGTACATCATGCCAAGACAACTCCTGAGGATTACGAGAAACTTGGTTTCCA GGGGGCTCAAGACTTGGCCAACATGTTCCGTTTCTACACCCTGAAACCTGATCGGAACATTCATCTGACC CTGCGACTCAACCCCAAAGCCCAGACACTGGACCAGTGGCTGGAGCAGCACAAAGGGGACTTTGCACAGC TGTGATCTTGAAGCATTTGTAGGGACAACAAGCACAACAAACACTCTTTCTTGTATACAGTTCTGTGTTT GGGTTTTTTTTCCCTCCCAAATAAAACCATTGTTATCACAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI
ACCN NM_026393
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC030039, AAH30039
RefSeq Size 1186 bp
RefSeq ORF 930 bp
Locus ID 67824
UniProt ID Q8K2T1
Cytogenetics 16 2.46 cM
Summary Redox sensor protein. Undergoes restructuring and subcellular redistribution in response to changes in intracellular NADPH/NADP(+) levels. At low NADPH concentrations the protein is found mainly as a monomer, and binds argininosuccinate synthase (ASS1), the enzyme involved in nitric oxide synthesis. Association with ASS1 impairs its activity and reduces the production of nitric oxide, which subsecuently prevents apoptosis. Under normal NADPH concentrations, the protein is found as a dimer and hides the binding site for ASS1. The homodimer binds one molecule of NADPH. Has higher affinity for NADPH than for NADP(+). Binding to NADPH is necessary to form a stable dimer (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1).
Write Your Own Review
You're reviewing:Nmral1 (NM_026393) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204373 Nmral1 (tGFP-tagged) - Mouse NmrA-like family domain containing 1 (Nmral1) 10 ug
$500.00
MR204373 Nmral1 (Myc-DDK-tagged) - Mouse NmrA-like family domain containing 1 (Nmral1) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204373L3 Lenti ORF clone of Nmral1 (Myc-DDK-tagged) - Mouse NmrA-like family domain containing 1 (Nmral1) 10 ug
$600.00
MR204373L4 Lenti ORF clone of Nmral1 (mGFP-tagged) - Mouse NmrA-like family domain containing 1 (Nmral1) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.