Arrdc4 (NM_025549) Mouse Untagged Clone

SKU
MC201306
Arrdc4 (untagged) - Mouse arrestin domain containing 4 (Arrdc4), transcript variant 2, (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Arrdc4
Synonyms 2410003C09Rik; AV216361
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC017528 sequence for NM_025549
GCGCTGTGGCCGTAGTGGCCCTGGGTGTGCGGCCGGCGCCCGTGACAGCAGCGTCGCGGAGCCGGCTACC CCGACCTGGGGCCACTGCGGATCTTGGTGGCAGAGCCGCATCGCCTGGCGGAATGGGAGGCGAGGCGGGA GCCGATGGTCCTCGGGGCCGTGTCAAGAGCTTGGGGCTAGTGTTCGAAGATGAGAGCAAGGGCTGCTACT CAAGCGGCGAGACAGTGGCCGGGCACGTGCTGCTGGAGGCGGCAGAGCCGGTGGCCCTGCGCGGACTGCG CCTGGAGGCCCAGGGCCGTGCCACCTCTGCCTGGGGCCCGAGCGCTGGGGCCAGGGTCTGCATCGGTGGG GGCTCTCCCGCAGCCTCCTCAGAAGTGGAATACTTGAACCTGCGGTTGAGTCTGCTGGAGGCCCCAGCTG GTGAAGGTGTCACCTTGTTACAACCAGGAAAACACGAGTTTCCCTTTCGCTTTCAGCTTCCGTCTGAACC TTTGGCAACATCGTTTACTGGGAAGTATGGCAGTATTCAGTACTGTGTGAGGGCTGTTTTGGAACGACCC CAAGTTCCAGATCAGAGCGTCAGACGAGAGCTCCAGGTTGTCAGTCACGTGGATGTCAACACACCGCCCT TATTGACTCCTATGCTGAAGACGCAGGAGAAAATGGTTGGCTGTTGGCTTTTCACCTCTGGTCCTGTGTC ACTGAGCGTCAAGATCGAGAGAAAGGGCTACTGTAACGGAGAAGCTATCCCTATCTATGCAGAAATAGAA AATTGTTCATCTCGGCTGGTTGTTCCCAAGGCAGCCATATTCCAAACCCAGACGTACTTGGCTAGTGGAA AGACAAAGACAGTCCGGCACATGGTTGCCAATGTTCGAGGAAACCACATTGGTTCTGGGAGTACGGACAC CTGGAATGGGAAGATGCTGAAGATCCCACCTGTCACCCCATCCATCCTGGATTGCTGCATCATCAGAGTG GACTACTCCTTAGCTGTAATCCAAGCTTCTTGAATCATTAAAAATACATAAAACAGAAAAAAAAAAAAAA A
Restriction Sites RsrII-NotI
ACCN NM_025549
Insert Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC017528, AAH17528
RefSeq Size 1051 bp
RefSeq ORF 891 bp
Locus ID 66412
UniProt ID A0A0B4J1F4
Cytogenetics 7 C
Summary Functions as an adapter recruiting ubiquitin-protein ligases to their specific substrates (PubMed:27462458). Plays a role in endocytosis of activated G protein-coupled receptors (GPCRs) (By similarity). Through an ubiquitination-dependent mechanism plays also a role in the incorporation of SLC11A2 into extracellular vesicles (PubMed:27462458). May play a role in glucose uptake (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Arrdc4 (NM_025549) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204099 Arrdc4 (tGFP-tagged) - Mouse arrestin domain containing 4 (Arrdc4), transcript variant 2 10 ug
$500.00
MR204099 Arrdc4 (Myc-DDK-tagged) - Mouse arrestin domain containing 4 (Arrdc4), transcript variant 2 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204099L3 Lenti ORF clone of Arrdc4 (Myc-DDK-tagged) - Mouse arrestin domain containing 4 (Arrdc4), transcript variant 2 10 ug
$600.00
MR204099L4 Lenti ORF clone of Arrdc4 (mGFP-tagged) - Mouse arrestin domain containing 4 (Arrdc4), transcript variant 2 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.