Glyat (NM_145935) Mouse Untagged Clone

SKU
MC201077
Glyat (untagged) - Mouse glycine-N-acyltransferase (Glyat), nuclear gene encoding mitochondrial protein, (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Glyat
Synonyms A330009E03Rik; ACGNAT; AI195249; AI315345; CAT; GAT
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC010799 sequence for NM_145935
CACCAAGCCTGCTGTATCAGACTTTCATCTCTCAGAAGTCCATTTTTACGAAGATTGCTGAGACAGCTTT CCAGGCTAAAGTGTCCTCATGATTGTTCCATTACAAGGTGCACAGATGCTACAAATGTTGGAGAAATCCT TGAGGAAGTACCTTCCTGAATCCTTAAAGGTTTATGGGACCGTCTATCACATGATCCATGGAAACCCATT CAACCTAAAAGCCCTAGTTGACAAGTGGCCTGATTTTAACACAGTGGTTGTCCGCCCTCAAGAACAGGAG ATGACAGATGACCTTGATTTCTACATCAATACTTACCAGGTCTACTCCAAAGACCCCCAGAACTGTCAGG AATTCCTGGAGTCCTCAGAAGTCATTAACTGGAAACAACATTTGCAGATTCAAAGTTCCCAGTCCCACCT GAATAAGACGATACAAAATCTTGCAAGCATCCAATCTTTTCAAATCAAACATTCAGAAAACATCCTCTAT GTATCATCAGAGACAATCAAGAAACTGTTCCCTTCCCTGCTGGATACAAAGAATTTATCGACAGGAAGTG GCAAGCCCAAGGCCATTGATCAAGACAAGTTTAAACTTTCATCCTTGGATGTTGTCCATGCTGCCTTGGT GAATAAATTCTGGCTTTTTGGTGGCAATGAGAGGAGCCAGAGATTCATTGAACGCTGCATAAAGAACTTC CCAAGTTCCTGTGTCCTGGGGCCTGAGGGAACCCCTGCATCTTGGACTCTAATGGACCAAACTGGAGAGA TGCGAATGGGAGGCACTATGCCTGAGTACCGGCTCCAAGGTCTTGTCTCCTTTGTTGTCCATTCACAAGA CCAGATTATGACAAAGCGTGGTTATCCTGTTTATTCTCACACGGAGAAAAGTAATATCGCTATGCAAAAA ATGAGTTACACACTGCAGCATCTCCCCATGCCCTGTGCCTGGAACCAATGGAAGTGCATGCCTATGTGAA GCTGGACTCAAACAGAAGCTGGTGTTGAGTGGGCCCAGGGATGTAACTGGTGGTGGACAAAGAGTGAAGA TTACTGAAAAGATAGAATAAATGGCAACTAGCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_145935
Insert Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC010799, AAH10799
RefSeq Size 1120 bp
RefSeq ORF 891 bp
Locus ID 107146
UniProt ID Q91XE0
Cytogenetics 19 A
Summary Mitochondrial acyltransferase which transfers an acyl group to the N-terminus of glycine and glutamine, although much less efficiently. Can conjugate a multitude of substrates to form a variety of N-acylglycines, thereby detoxify xenobiotics, such as benzoic acid or salicylic acid, and endogenous organic acids, such as isovaleric acid.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Glyat (NM_145935) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204089 Glyat (tGFP-tagged) - Mouse glycine-N-acyltransferase (Glyat) 10 ug
$500.00
MR204089 Glyat (Myc-DDK-tagged) - Mouse glycine-N-acyltransferase (Glyat), nuclear gene encoding mitochondrial protein 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204089L3 Lenti ORF clone of Glyat (Myc-DDK-tagged) - Mouse glycine-N-acyltransferase (Glyat), nuclear gene encoding mitochondrial protein 10 ug
$600.00
MR204089L4 Lenti ORF clone of Glyat (mGFP-tagged) - Mouse glycine-N-acyltransferase (Glyat), nuclear gene encoding mitochondrial protein 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.