Pyy (NM_145435) Mouse Untagged Clone

SKU
MC201072
Pyy (untagged) - Mouse peptide YY (Pyy), (10ug)
$150.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pyy
Synonyms MGC19143
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC010821 sequence for NM_145435
CCTCCTGCTCATCTTGCTTCGGAAGCTGTAGCTGCTATGGTGGCGGTGCGCAGGCCTTGGCCCGTCACGG TCGCAATGCTGCTAATCCTGCTCGCCTGTCTGGGAGCCCTGGTGGACGCCTACCCTGCCAAACCAGAGGC TCCCGGCGAAGACGCCTCCCCGGAGGAGCTGAGCCGCTACTACGCCTCCCTGCGCCACTACCTCAACCTG GTCACCCGGCAGCGGTATGGAAAAAGAGATGTCCCCGCAGCTCTGTTCTCCAAACTGCTCTTCACAGACG ACAGCGACAGCGAGAACCTCCCCTTCAGGCCAGAAGGTTTGGACCAGTGGTGAAGACTCCCCCAAGGCCT CCTGCGAGATGTGTTAACTACACCGACTTCACTTGCATGTTTGGTTTAAGAAGAGGGCACTTCATATCTC GGTGTCTCGGACACCCAGACTGGAGGGCTGTGTGTGTTCATTTCCCTGTCCCTAAATAAAAAGCAAATTT CGCACAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_145435
Insert Size 297 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC010821, AAH10821
RefSeq Size 511 bp
RefSeq ORF 297 bp
Locus ID 217212
UniProt ID Q9EPS2
Cytogenetics 11 D
Summary This gut peptide inhibits exocrine pancreatic secretion, has a vasoconstrictory action and inhibitis jejunal and colonic mobility.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Pyy (NM_145435) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG200292 Pyy (tGFP-tagged) - Mouse peptide YY (Pyy) 10 ug
$350.00
MR200292 Pyy (Myc-DDK-tagged) - Mouse peptide YY (Pyy) 10 ug
$289.00
MR200292L3 Lenti ORF clone of Pyy (Myc-DDK-tagged) - Mouse peptide YY (Pyy) 10 ug
$450.00
MR200292L4 Lenti ORF clone of Pyy (mGFP-tagged) - Mouse peptide YY (Pyy) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.