Igfbp6 (NM_008344) Mouse Untagged Clone

SKU
MC200871
Igfbp6 (untagged) - Mouse insulin-like growth factor binding protein 6 (Igfbp6), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Igfbp6
Synonyms IGFBP-6
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC012723 sequence for NM_008344
CCACGCCGTCCGGCAGCAGCAGCTGCACTGGACTCTCTGGAAGGAGTGTACAGGGCAAAAACTCTGACCA TGACCTGGGATGGGCTGCCCACGCAGCCGCTGCTCATGCTGCTAATGCTGTTGTTCGCTGCGGGCTCAGG GTCCGCCTTAGCGGGGTGCCCCGGCTGCGGCGCTGGGATGCAGACTGGTTGTCGCGGGGGCTGCGTGGAG GAGGAAGACGCGGGATCGCCTGCAGACGGCTGTACAGAAGCCGGAGGCTGTCTCAGGAGAGAGGGACAAC CGTGCGGGGTCTACAGCCCTAAGTGCGCCCCAGGACTGCAGTGCCAACCCCGAGAGAACGAAGAGGCGCC TTTGCGGGCGCTGCTAATCGGCCAGGGCCGCTGTCAACGCGCCAGAGGGCCGTCGGAGGAGACTACAAAG GAGAGCAAACCCCAAGGAGGTGCCTCCCGCTCTCGTGACACAAACCACAGAGACCGGCAGAAGAATCCAC GGACCTCTGCTGCCCCTATACGGCCCAATCCTGTTCAAGATAGTGAGATGGGCCCCTGCCGCAGACACTT GGATTCAGTACTGCAGCAGCTCCAGACTGAGGTCTTCCGAGGCGGAGCACGTGGGCTCTATGTGCCAAAC TGTGACCTCAGAGGCTTCTACCGAAAGCAGCAGTGTCGTTCCTCGCAGGGGAATCGCCGTGGCCCCTGCT GGTGTGTGGATCCGATGGGCCAGCCTTTGCCAGTGTCTCCAGATGGTCAAGGAAGCACTCAGTGCTCTGC CAGGAGCAGTGGGTGAAGCCCCGAGGGAGCCTCCAGGACGCCAGCAGGAACAGGGGGCTGTCATTTGAGC TGTATGTGAAGCAATGAATAACTCTGTGCCCCAAGACCCACCTTCACGCCCCACCCCATTGTCCCTGTCA CCCTTGGGCCTTTACACAGCTAGTTAGAAAGATTGCTGTTGGCTTGTGTACTAATAAAACAGTATTGGGG GGGTGTCTCTGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_008344
Insert Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC012723, AAH12723
RefSeq Size 1046 bp
RefSeq ORF 717 bp
Locus ID 16012
UniProt ID P47880
Cytogenetics 15 F2
Summary IGF-binding proteins prolong the half-life of the IGFs and have been shown to either inhibit or stimulate the growth promoting effects of the IGFs on cell culture. They alter the interaction of IGFs with their cell surface receptors.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Igfbp6 (NM_008344) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG202918 Igfbp6 (tGFP-tagged) - Mouse insulin-like growth factor binding protein 6 (Igfbp6) 10 ug
$500.00
MR202918 Igfbp6 (Myc-DDK-tagged) - Mouse insulin-like growth factor binding protein 6 (Igfbp6) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR202918L3 Lenti ORF clone of Igfbp6 (Myc-DDK-tagged) - Mouse insulin-like growth factor binding protein 6 (Igfbp6) 10 ug
$600.00
MR202918L4 Lenti ORF clone of Igfbp6 (mGFP-tagged) - Mouse insulin-like growth factor binding protein 6 (Igfbp6) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.