Mapk12 (NM_013871) Mouse Untagged Clone

SKU
MC200742
Mapk12 (untagged) - Mouse mitogen-activated protein kinase 12 (Mapk12), (10ug)
$457.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mapk12
Synonyms AW123708; Erk6; P38gamma; Prkm12; Sapk3
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC021640 sequence for NM_013871
CCACGCGTCCGGAGCCCGCAAAGGAAAATCTCAGAGGCGGGCAGGCGGGTAGCCGGCGCGGAGTACGCCC TGCCACGCAGTGACCCGGGGCGCGCGGGCGGAGCCCCTGATCCCGGGTCCGGTCCTGGGGCGCGGTGCTC CGGCTGGGGATGAGCTCCCCGCCACCCGCCCGCAAGGGCTTTTACCGCCAGGAGGTGACCAAAACGGCCT GGGAGGTGCGCGCCGTGTACCAAGACCTGCAGCCCGTTGGCTCTGGTGCCTATGGTGCAGTGTGCTCTGC AGTAGACAGCCGCACTGGCAACAAGGTGGCCATCAAGAAGTTGTACCGGCCCTTCCAGTCGGAGCTGTTT GCCAAGCGCGCCTACAGAGAGTTGCGCCTCCTCAAACACATGCGCCACGAGAACGTCATTGGGCTACTGG ATGTGTTCACACCTGATGAGTCTCTGGACGACTTCACAGACTTCTACCTGGTGATGCCATTCATGGGCAC TGATCTGGGCAAACTCATGAAGCATGAGACCCTGAGTGAAGACAGAATCCAGTTTCTTGTGTATCAGATG TTGAAGGGGCTGAAGTATATCCATGCGGCTGGTGTCATCCACAGAGACTTGAAGCCTGGCAACCTGGCTG TGAATGAGGACTGTGAGCTGAAGATCCTAGACTTTGGCCTTGCCAGGCAGGCAGACAGTGAGATGACAGG ATATGTGGTAACCCGGTGGTATCGGGCACCAGAGGTCATCTTGAATTGGATGCGCTACACGCAGACAGTG GACATTTGGTCCGTTGGCTGCATCATGGCGGAGATGATTACTGGGAAGATCCTGTTCAAAGGCAATGACC ACCTGGACCAGCTGAAGGAGATCATGAAGATCACAGGGACGCCCCCTCCTGAGTTTGTTCAGAAGCTACA GAGTGCAGAGGCCAAGAACTACATGGAAGGCCTCCCTGAGTTAGAAAAGAAGGATTTTGCCTCTGTCCTG ACCAACGCAAGCCCTCAGGCTGTGAATCTCCTGGAAAGGATGCTGGTGCTGGATGCGGAACAGCGGGTGA CAGCAGCTGAGGCGTTAACCCATCCATACTTTGAGTCCCTTCGGGACACTGAGGATGAACCCAAGGCCCA GAAATATGACGACTCCTTTGATGATGTAGACCGCACCCTTGAGGAATGGAAGCGTGTGACTTACAAGGAA GTTCTCAGCTTCAAGCCTCCTAGGCAGCTAGGAGCCAGAGTTCCAAAGGAGACGGCTCTGTGACGACCTC TGGGTGGTTTGGGGGGTATCCAAAGGAGGTTGGCTCGGAGCTTCACGGCACCTTGGCTTCCCTTCTCTGG AAAAGGAATCCTGGTTAACACCCCGACAGTGCCTGGAGCTTGTATCCCAAGTCTTCCACCTGGACATGCT GTGTAGACCCTTGAATCATGAACCCTCCATCTCCAAACCTGTTCTTCGGCTTTCGAGTGCCCCAGATGAC CCTGGAAGAACATCTAAGCTTTCTGTCCAAGACCCCTACCCAACATGGGACTAGCCTTTGAATTCTGGAG TTGTACATGAAATCAGTATTCGTGAAAAAGCTTCAGAGTGAGCAGAGCTTAGGAGACAAGTGCCAGACCT GAGCTCTGCTCGCTCTGGACAATGCCAAGGCCAACTCCTGAGACGGAATGAGACAGAGGTTTTGGGGACA CTGACTCAGGGACATCATCTCTTCTGGAAGTGGGTGGATTCTCTTACACCCTTAGCCTGGAATTCGAACC AGCCATTTGGTGTTGCCTAAGTGGCTGGGGGCAAATAAACCCTTTTGTAGATCTCCCAAAAAAAAAAAAA AAAAAA
Restriction Sites RsrII-NotI
ACCN NM_013871
Insert Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC021640, AAH21640
RefSeq Size 1826 bp
RefSeq ORF 1104 bp
Locus ID 29857
UniProt ID O08911
Cytogenetics 15 E3
Summary Serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction pathway. MAPK12 is one of the four p38 MAPKs which play an important role in the cascades of cellular responses evoked by extracellular stimuli such as proinflammatory cytokines or physical stress leading to direct activation of transcription factors such as ELK1 and ATF2. Accordingly, p38 MAPKs phosphorylate a broad range of proteins and it has been estimated that they may have approximately 200 to 300 substrates each. Some of the targets are downstream kinases such as MAPKAPK2, which are activated through phosphorylation and further phosphorylate additional targets. Plays a role in myoblast differentiation and also in the down-regulation of cyclin D1 in response to hypoxia in adrenal cells suggesting MAPK12 may inhibit cell proliferation while promoting differentiation. Phosphorylates DLG1. Following osmotic shock, MAPK12 in the cell nucleus increases its association with nuclear DLG1, thereby causing dissociation of DLG1-SFPQ complexes. This function is independent of its catalytic activity and could affect mRNA processing and/or gene transcription to aid cell adaptation to osmolarity changes in the environment. Regulates UV-induced checkpoint signaling and repair of UV-induced DNA damage and G2 arrest after gamma-radiation exposure. MAPK12 is involved in the regulation of SLC2A1 expression and basal glucose uptake in L6 myotubes; and negatively regulates SLC2A4 expression and contraction-mediated glucose uptake in adult skeletal muscle. C-Jun (JUN) phosphorylation is stimulated by MAPK14 and inhibited by MAPK12, leading to a distinct AP-1 regulation. MAPK12 is required for the normal kinetochore localization of PLK1, prevents chromosomal instability and supports mitotic cell viability. MAPK12-signaling is also positively regulating the expansion of transient amplifying myogenic precursor cells during muscle growth and regeneration.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Mapk12 (NM_013871) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG205654 Mapk12 (tGFP-tagged) - Mouse mitogen-activated protein kinase 12 (Mapk12) 10 ug
$657.00
MR205654 Mapk12 (Myc-DDK-tagged) - Mouse mitogen-activated protein kinase 12 (Mapk12) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR205654L3 Lenti ORF clone of Mapk12 (Myc-DDK-tagged) - Mouse mitogen-activated protein kinase 12 (Mapk12) 10 ug
$757.00
MR205654L4 Lenti ORF clone of Mapk12 (mGFP-tagged) - Mouse mitogen-activated protein kinase 12 (Mapk12) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.