Cib2 (NM_019686) Mouse Untagged Clone

SKU
MC200563
Cib2 (untagged) - Mouse calcium and integrin binding family member 2 (Cib2), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cib2
Synonyms 2810434I23Rik; AI449053
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC005739 sequence for NM_019686
CGGACGCGTGGGCCGGGCTCGGGGCTCCAGACGCCGCCGATGGGAAGCAGCACTCGAAAGGGCGAGAGAC GACGCCGCGGCCACCCATACCATCGCGGTCACCATGGGGAACAAGCAGACCATCTTCACTGAAGAGCAGC TGGACAACTACCAGGACTGCACTTTCTTCAATAAGAAGGACATCCTCAAGCTTCATGCACGGTTCTATGA GCTGGCTCCCAACCTCGTCCCGATGGACTACAGGAAGAGTCCCATCGTCCATGTACCCATGAGCCTCATC ATTCAGATGCCGGAGCTCCGGGAGAATCCCTTCAAAGAGAGGATTGTGGAGGCTTTCTCCGAGGATGGCG AGGGGAACCTCACCTTCAATGACTTTGTGGACATGTTCTCTGTGCTCTGCGAATCAGCGCCTCGGGAGCT CAAGGCAAACTATGCCTTCAAGATCTATGACTTCAACACTGACAATTTTATCTGTAAAGAAGACTTAGAG ATGACGCTGGCCCGACTCACCAAGTCTGAGTTGGAAGAGGATGAGGTAGTGCTTGTGTGTGACAAAGTCA TTGAAGAGGCTGACCTGGATGGTGACGGCAAGCTGGGCTTTGCTGACTTTGAGGACATGATCGCCAAGGC CCCTGATTTTCTCAGCACCTTCCACATTCGAATCTGAAGACACTGCCAAGGCCGTGGGGGCCTAGAGCTG CATCCTCTGGCCTGCTGTCTGTGCAGGTATGGTTTCCAAGTGCTCCAGGGAAGGAGCTGTGGCCTCTGGG GTTCTCACCCATGGACATTTCCTGTGGCCCTTTCAGCAAAAAAATTAAAATAAAATAAAATAAAATAAAA TAAAATAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_019686
Insert Size 564 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC005739, AAH05739
RefSeq Size 867 bp
RefSeq ORF 564 bp
Locus ID 56506
UniProt ID Q9Z309
Cytogenetics 9 A5.3
Summary Calcium-binding protein critical for proper photoreceptor cell maintenance and function. Plays a role in intracellular calcium homeostasis by decreasing ATP-induced calcium release (PubMed:23023331). May be involved in the mechanotransduction process (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Cib2 (NM_019686) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG201750 Cib2 (tGFP-tagged) - Mouse calcium and integrin binding family member 2 (Cib2) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
MR201750 Cib2 (Myc-DDK-tagged) - Mouse calcium and integrin binding family member 2 (Cib2) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR201750L3 Lenti ORF clone of Cib2 (Myc-DDK-tagged) - Mouse calcium and integrin binding family member 2 (Cib2) 10 ug
$600.00
MR201750L4 Lenti ORF clone of Cib2 (mGFP-tagged) - Mouse calcium and integrin binding family member 2 (Cib2) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.