Lgals9 (BC003754) Mouse Untagged Clone
SKU
MC200520
Lgals9 (untagged) - Mouse lectin, galactose binding, soluble 9 (cDNA clone MGC:5882 IMAGE:3601419), (10ug)
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Lgals9 |
Synonyms | AA407335; AI194909; AI265545; gal-9; galectin-9; Lgals5; LGALS35 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>BC003754
AGGAAGAGAGCATTGGTTCCCCTGAGATAGAAGAGATGGCTCTCTTCAGTGCCCAGTCTCCATACATTAA CCCGATCATCCCCTTTACTGGACCAATCCAAGGAGGGCTGCAGGAGGGACTTCAGGTGACCCTCCAGGGG ACTACCAAGAGTTTTGCACAAAGGTTTGTGGTGAACTTTCAGAACAGCTTCAATGGAAATGACATTGCCT TCCACTTCAACCCCCGGTTTGAGGAAGGAGGGTATGTGGTTTGCAACACGAAGCAGAACGGACAGTGGGG GCCTGAGGAGAGAAAGATGCAGATGCCCTTCCAGAAGGGGATGCCCTTTGAGCTTTGCTTCCTGGTGCAG AGGTCAGAGTTCAAGGTGATGGTGAACAAGAAATTCTTTGTGCAGTACCAACACCGCGTACCCTACCACC TCGTGGACACCATCGCTGTCTCCGGCTGCTTGAAGCTGTCCTTTATCACCTTCCAGACTCAGGACTTTCG TCCTGCCCACCAGGCACCCATGGCTCAAACTACCATCCATATGGTTCACAGCACCCCTGGACAGATGTTC TCTACTCCTGGAATCCCTCCTGTGGTGTACCCCACCCCAGCCTATACCATACCTTTCTACACCCCCATTC CAAATGGGCTTTACCCGTCCAAGTCCATCATGATATCAGGCAATGTCTTGCCAGATGCTACGAGGTTCCA TATCAACCTTCGCTGTGGAGGTGACATTGCTTTCCACCTGAACCCCCGTTTCAATGAGAATGCTGTTGTC CGAAACACTCAGATCAACAACTCCTGGGGGCAGGAAGAGCGAAGTCTGCTTGGGAGGATGCCCTTCAGTC GAGGCCAGAGCTTCTCGGTGTGGATCATATGCGAAGGTCACTGCTTCAAGGTGGCTGTGAATGGTCAACA CATGTGTGAATATTACCACCGCCTGAAGAACTTGCAGGATATCAACACTCTAGAAGTGGCGGGTGATATC CAGCTGACCCACGTGCAGACATAGGCAAGGTCTCTGGCCTAGGGATAAGGGCTGGAGCACCCTGCCTGTG TCTTATCTTTCCCCTGTCTCAGCCCTGGCACCATCAGAAGAGATCATCACTTATAGGAATTCCAGGAAGG TGAAATTCCCAATTGACTCCCTCCACAAAGGGGGTTTTCTAGGCTGTGTGGCACATGGCTGTCAGCCCAT AGTCTGAGCCATTGCCCCCAAGCTAGCTATATACTGAGGGAAGTGACCCTCCTGGGTTTGCTCAGATCTC TGATCGTTCCCCCCTCTGTGGCCCTTTTCTTTCACCCCTCCAGGAGAGCCACCCTGATATCATCCCACTG GCCTCCAACTGACCCACAATGTCCACAATAACTTTCCCCCATTCTCACCCAGTATCCATAAAATAAAGAA ATAATATTGCTTGTCTACAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | BC003754 |
Insert Size | 969 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | BC003754, AAH03754 |
RefSeq Size | 1433 bp |
RefSeq ORF | 969 bp |
Locus ID | 16859 |
Cytogenetics | 11 B5 |
Summary | Binds galactosides (By similarity). Has high affinity for the Forssman pentasaccharide (By similarity). Ligand for HAVCR2/TIM3 (By similarity). Binding to HAVCR2 induces T-helper type 1 lymphocyte (Th1) death (By similarity). Also stimulates bactericidal activity in infected macrophages by causing macrophage activation and IL1B secretion which restricts intracellular bacterial growth (PubMed:20937702). Ligand for P4HB; the interaction retains P4HB at the cell surface of Th2 T-helper cells, increasing disulfide reductase activity at the plasma membrane, altering the plasma membrane redox state and enhancing cell migration (PubMed:21670307). Ligand for CD44; the interaction enhances binding of SMAD3 to the FOXP3 promoter, leading to up-regulation of FOXP3 expression and increased induced regulatory T (iTreg) cell stability and suppressive function (PubMed:25065622). Promotes ability of mesenchymal stromal cells to suppress T-cell proliferation (By similarity). Expands regulatory T-cells and induces cytotoxic T-cell apoptosis following virus infection (By similarity). Activates ERK1/2 phosphorylation inducing cytokine (IL-6, IL-8, IL-12) and chemokine (CCL2) production in mast and dendritic cells (By similarity). Inhibits degranulation and induces apoptosis of mast cells (By similarity). Induces maturation and migration of dendritic cells (By similarity). Inhibits natural killer (NK) cell function (PubMed:23408620). Can transform NK cell phenotype from peripheral to decidual during pregnancy (By similarity). Astrocyte derived galectin-9 enhances microglial TNF production (PubMed:25158758). May play a role in thymocyte-epithelial interactions relevant to the biology of the thymus. May provide the molecular basis for urate flux across cell membranes, allowing urate that is formed during purine metabolism to efflux from cells and serving as an electrogenic transporter that plays an important role in renal and gastrointestinal urate excretion (By similarity). Highly selective to the anion urate (By similarity).[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG204650 | Lgals9 (tGFP-tagged) - Mouse lectin, galactose binding, soluble 9 (cDNA clone MGC:5882 IMAGE:3601419) | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.