Sftpd (NM_009160) Mouse Untagged Clone

SKU
MC200505
Sftpd (untagged) - Mouse surfactant associated protein D (Sftpd), (10ug)
$457.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Sftpd
Synonyms AI573415; Sfpd; Sftp4; SP-D
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC003705 sequence for NM_009160
CCTGGGGCCAACAAGGAAGCAATCTGACATGCTGCCCTTTCTCTCCATGCTTGTCTTGCTTGTACAGCCC CTGGGAAATCTGGGAGCAGAAATGAAGAGCCTCTCGCAGAGATCAGTACCCAACACCTGCACCCTAGTCA TGTGTAGCCCAACAGAGAATGGCCTGCCTGGTCGTGATGGACGGGATGGGAGAGAAGGTCCACGGGGTGA GAAGGGTGATCCAGGTTTGCCAGGACCTATGGGGCTCTCAGGGTTGCAGGGCCCTACAGGTCCAGTTGGA CCCAAAGGAGAGAATGGCTCTGCTGGCGAACCTGGACCAAAGGGAGAACGTGGACTAAGTGGACCTCCAG GACTTCCAGGTATTCCTGGTCCAGCTGGGAAAGAAGGTCCCTCTGGGAAGCAGGGGAACATAGGACCTCA AGGCAAACCAGGTCCTAAAGGAGAGGCTGGGCCCAAAGGAGAAGTAGGTGCTCCTGGCATGCAAGGATCT ACAGGGGCAAAAGGCTCCACAGGCCCCAAGGGAGAAAGAGGTGCCCCTGGTGTGCAAGGAGCCCCAGGGA ATGCTGGAGCAGCAGGACCTGCCGGACCTGCCGGTCCACAGGGAGCTCCAGGTTCCAGGGGGCCCCCAGG ACTCAAGGGGGACAGAGGTGTTCCTGGAGACAGAGGAATCAAAGGTGAAAGCGGGCTTCCAGACAGTGCT GCTCTGAGGCAGCAGATGGAGGCCTTAAAAGGAAAACTACAGCGTCTAGAGGTTGCCTTCTCCCACTATC AGAAAGCTGCATTGTTCCCTGATGGCCGAAGTGTTGGAGACAAGATCTTCAGGACAGCAGACTCTGAAAA GCCTTTTGAGGATGCCCAGGAGATGTGCAAACAGGCTGGAGGACAGCTGGCCTCCCCACGTTCTGCTACT GAGAATGCTGCCATACAGCAACTCATCACAGCCCACAACAAGGCTGCTTTCCTGAGTATGACAGATGTGG GCACAGAGGGCAAGTTCACTTACCCCACAGGAGAGCCCCTGGTCTATTCTAATTGGGCTCCAGGGGAGCC CAACAACAATGGTGGAGCAGAGAACTGTGTGGAGATCTTCACCAATGGGCAATGGAATGATAAGGCTTGT GGAGAGCAGCGCCTTGTTATCTGTGAGTTCTGAGCCACTGGAGGTAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_009160
Insert Size 1125 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC003705, AAH03705
RefSeq Size 1183 bp
RefSeq ORF 1125 bp
Locus ID 20390
UniProt ID P50404
Cytogenetics 14 22.36 cM
Summary Contributes to the lung's defense against inhaled microorganisms, organic antigens and toxins. Interacts with compounds such as bacterial lipopolysaccharides, oligosaccharides and fatty acids and modulates leukocyte action in immune response. May participate in the extracellular reorganization or turnover of pulmonary surfactant. Binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieties.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Sftpd (NM_009160) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG205806 Sftpd (tGFP-tagged) - Mouse surfactant associated protein D (Sftpd) 10 ug
$657.00
MR205806 Sftpd (Myc-DDK-tagged) - Mouse surfactant associated protein D (Sftpd) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR205806L3 Lenti ORF clone of Sftpd (Myc-DDK-tagged) - Mouse surfactant associated protein D (Sftpd) 10 ug
$757.00
MR205806L4 Lenti ORF clone of Sftpd (mGFP-tagged) - Mouse surfactant associated protein D (Sftpd) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.