Ccl6 (NM_009139) Mouse Untagged Clone

SKU
MC200115
Ccl6 (untagged) - Mouse chemokine (C-C motif) ligand 6 (Ccl6), (10ug)
$150.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ccl6
Synonyms c10; MRP-1; Scya6
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC002073 sequence for NM_009139
CAAAAATCCTCAGACCAGCTGGGCCTGTCCTCCAGGAGGATGAGAAACTCCAAGACTGCCATTTCATTCT TTATCCTTGTGGCTGTCCTTGGGTCCCAGGCTGGCCTCATACAAGAAATGGAAAAAGAAGATCGTCGCTA TAACCCTCCAATAATTCATCAAGGCGTTCAAGACACTTCTTCAGACTGCTGCTTCTCCTATGCCACACAG ATCCCGTGTAAAAGATTTATATATTATTTCCCCACTAGTGGTGGGTGCATCAAGCCGGGCATCATCTTTA TCAGCAGGAGGGGAACCCAGGTCTGTGCCGACCCCAGCGATCGGAGAGTTCAGAGGTGCCTAAGCACCCT GAAGCAAGGCCCAAGATCTAGGAACAAGGTCATTGCTTGAGAAGGAGGGCAGGCATTGTCACCCACTTTC TTCTGTCTTCCCCAGTGACCGCCTGCCTAGGAGACCTTGTTTTTATAGATATTTAAAGCATTTATCCTTC TGTTCAGGTTTAGAGCAGTCAACAGTATTCATGTGGACTCCGCCTGACACGGTTAGAGCCATCTGGAGTT GTAAACATCAAGATTGTCTTTGAGTAATTGTTGGGTTTTCTTGTGGTTTCTCAGCAGATTATAAATGGAT AAATTATTAGGGTAGTCTTTGGGGCTTTGGAATGTGTCTGGTTCTGATACAAGCTTAAGCCGGGTAATAT CCAGCTGAGATGAAATCAATTTTGCCCTAGGCCATACATATGTCCAGCTTTGTGGGTTCCCAGTTGTTCG CCCTGCCACAATAGAGCAATGAGTACCCCCAATAAAGTCCACTCCATGTAGCCAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_009139
Insert Size 351 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC002073, AAH02073
RefSeq Size 900 bp
RefSeq ORF 351 bp
Locus ID 20305
UniProt ID P27784
Cytogenetics 11 50.85 cM
Summary CCL6(22-95) and CCL6(23-95) are potent chemoattractants.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Ccl6 (NM_009139) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG200502 Ccl6 (tGFP-tagged) - Mouse chemokine (C-C motif) ligand 6 (Ccl6) 10 ug
$489.00
MR200502 Ccl6 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 6 (Ccl6) 10 ug
$289.00
MR200502L3 Lenti ORF clone of Ccl6 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 6 (Ccl6) 10 ug
$450.00
MR200502L4 Lenti ORF clone of Ccl6 (mGFP-tagged) - Mouse chemokine (C-C motif) ligand 6 (Ccl6) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.