MET (NM_001127500) Human 3' UTR Clone

CAT#: SC218300

3`UTR clone of met proto-oncogene (hepatocyte growth factor receptor) (MET) transcript variant 1 for miRNA target validation

Clone Modification / Custom Cloning Service

USD 629.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MET (NM_001127500) Human 3' UTR Clone
Vector pMirTarget
Symbol MET
Synonyms AUTS9; c-Met; DFNB97; HGFR; RCCP2
ACCN NM_001127500
Insert Size 2306
Sequence Data
>SC218300 3'UTR clone of NM_001127500
The sequence shown below is from the reference sequence of NM_001127500. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGATGAGGTGGACACACGACCAGCCTCCTTCTGGGAGACATCATAGTGCTAGTACTATGTCAAAGCAACA
GTCCACACTTTGTCCAATGGTTTTTTCACTGCCTGACCTTTAAAAGGCCATCGATATTCTTTGCTCTTGC
CAAAATTGCACTATTATAGGACTTGTATTGTTATTTAAATTACTGGATTCTAAGGAATTTCTTATCTGAC
AGAGCATCAGAACCAGAGGCTTGGTCCCACAGGCCACGGACCAATGGCCTGCAGCCGTGACAACACTCCT
GTCATATTGGAGTCCAAAACTTGAATTCTGGGTTGAATTTTTTAAAAATCAGGTACCACTTGATTTCATA
TGGGAAATTGAAGCAGGAAATATTGAGGGCTTCTTGATCACAGAAAACTCAGAAGAGATAGTAATGCTCA
GGACAGGAGCGGCAGCCCCAGAACAGGCCACTCATTTAGAATTCTAGTGTTTCAAAACACTTTTGTGTGT
TGTATGGTCAATAACATTTTTCATTACTGATGGTGTCATTCACCCATTAGGTAAACATTCCCTTTTAAAT
GTTTGTTTGTTTTTTGAGACAGGATCTCACTCTGTTGCCAGGGCTGTAGTGCAGTGGTGTGATCATAGCT
CACTGCAACCTCCACCTCCCAGGCTCAAGCCTCCCGAATAGCTGGGACTACAGGCGCACACCACCATCCC
CGGCTAATTTTTGTATTTTTTGTAGAGACGGGGTTTTGCCATGTTGCCAAGGCTGGTTTCAAACTCCTGG
ACTCAAGAAATCCACCCACCTCAGCCTCCCAAAGTGCTAGGATTACAGGCATGAGCCACTGCGCCCAGCC
CTTATAAATTTTTGTATAGACATTCCTTTGGTTGGAAGAATATTTATAGGCAATACAGTCAAAGTTTCAA
AATAGCATCACACAAAACATGTTTATAAATGAACAGGATGTAATGTACATAGATGACATTAAGAAAATTT
GTATGAAATAATTTAGTCATCATGAAATATTTAGTTGTCATATAAAAACCCACTGTTTGAGAATGATGCT
ACTCTGATCTAATGAATGTGAACATGTAGATGTTTTGTGTGTATTTTTTTAAATGAAAACTCAAAATAAG
ACAAGTAATTTGTTGATAAATATTTTTAAAGATAACTCAGCATGTTTGTAAAGCAGGATACATTTTACTA
AAAGGTTCATTGGTTCCAATCACAGCTCATAGGTAGAGCAAAGAAAGGGTGGATGGATTGAAAAGATTAG
CCTCTGTCTCGGTGGCAGGTTCCCACCTCGCAAGCAATTGGAAACAAAACTTTTGGGGAGTTTTATTTTG
CATTAGGGTGTGTTTTATGTTAAGCAAAACATACTTTAGAAACAAATGAAAAAGGCAATTGAAAATCCCA
GCTATTTCACCTAGATGGAATAGCCACCCTGAGCAGAACTTTGTGATGCTTCATTCTGTGGAATTTTGTG
CTTGCTACTGTATAGTGCATGTGGTGTAGGTTACTCTAACTGGTTTTGTCGACGTAAACATTTAAAGTGT
TATATTTTTTATAAAAATGTTTATTTTTAATGATATGAGAAAAATTTTGTTAGGCCACAAAAACACTGCA
CTGTGAACATTTTAGAAAAGGTATGTCAGACTGGGATTAATGACAGCATGATTTTCAATGACTGTAAATT
GCGATAAGGAAATGTACTGATTGCCAATACACCCCACCCTCATTACATCATCAGGACTTGAAGCCAAGGG
TTAACCCAGCAAGCTACAAAGAGGGTGTGTCACACTGAAACTCAATAGTTGAGTTTGGCTGTTGTTGCAG
GAAAATGATTATAACTAAAAGCTCTCTGATAGTGCAGAGACTTACCAGAAGACACAAGGAATTGTACTGA
AGAGCTATTACAATCCAAATATTGCCGTTTCATAAATGTAATAAGTAATACTAATTCACAGAGTATTGTA
AATGGTGGATGACAAAAGAAAATCTGCTCTGTGGAAAGAAAGAACTGTCTCTACCAGGGTCAAGAGCATG
AACGCATCAATAGAAAGAACTCGGGGAAACATCCCATCAACAGGACTACACACTTGTATATACATTCTTG
AGAACACTGCAATGTGAAAATCACGTTTGCTATTTATAAACTTGTCCTTAGATTAATGTGTCTGGACAGA
TTGTGGGAGTAAGTGATTCTTCTAAGAATTAGATACTTGTCACTGCCTATACCTGCAGCTGAACTGAATG
GTACTTCGTATGTTAATAGTTGTTCTGATAAATCATGCAATTAAAGTAAAGTGATGCAACATCTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001127500.1
Synonyms AUTS9; c-Met; DFNB97; HGFR; RCCP2
Summary This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016].
Locus ID 4233
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents