POLD3 (NM_006591) Human 3' UTR Clone

CAT#: SC217193

3`UTR clone of polymerase (DNA-directed) delta 3 accessory subunit (POLD3) for miRNA target validation

Change vector?

USD 629.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name POLD3 (NM_006591) Human 3' UTR Clone
Vector pMirTarget
Symbol POLD3
Synonyms P66; P68; PPP1R128
ACCN NM_006591
Insert Size 1961
Sequence Data
Insert Sequence
>SC217193 3'UTR clone of NM_006591
The sequence shown below is from the reference sequence of NM_006591. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGTGTCCATTACTGGCTTCTTCCAGAGGAAATAAACTGCCATCTCTGGTAGATCAGAGACTTGGAGTGGT
CAAGGGAGAAGACCAAGAAATGTACTCCTCACTTACTATGTAAGTTCATCTAGATCTCCACCTCACCTGT
ATCAAAAGACTGTTCTTTCATCCTGTGAGGTTTATACTATTTCTGGTTTTTAACCAAAAGGAAATCATCT
GGAAGCAGGAGGCAAAAAGCTGTTACCTTCTAATGACATTTAAAAAGCACAGTCTTTGACCTGTCCAGGA
GAAGGATTTACTCCAAAATTATACTGGAACAGTTTTCAGAATTCTCACTGAAGCCATTTAGTGGCTAACC
CACTGTGCTCCACTCACCCTATGCCCTGGTCCGCATATGGCACAGGAATTATTCCTTCTTGTTCCTCTGT
ATTCTAAGAATTCATGTGGGTGTTTCTTATCCTTACATTCTGCTGGATACGTTTACCCCTCTTGTCTTCC
TGCAGTACCACACTTCTGTCCCCTAACCTCCTGAGGCTGTTCTCTGTAAGTCTTTTAAGTTTTGGTTGGA
CTAAAGGCTGAAGTGAAAATCTCCCTGTAATCCTCTTCCTCCATTATGCAGTACACGGACACCTGGCTAC
AGACCAGGACGTGGCTTGTGTTCTGTTCCTTTCACAAAAGCTCTCTGGGACCTTCACTTGCAATTAGTGG
TTAGGGAAAAGCCTCAGGCAGAACACAAATAGAAATTTAATGATGTGTTCAACTCCACCAGAAATTACCT
CGAGTCAGCATTGACGATATTGGAGGAGCTGCCGTGCTGCTGATACGGGGTGTGCTTTATGCTGCTCTTT
GCGGTTTGTTGATCCCCTCCTCCCCCACTCTCAATACCTAGAGAGTGAAACCCGTACAATGAGATAAAGA
CTAAAAAGAGAAATCCCTTCCTATATACAGTGTGCTACATTTACAAAAAATTTCTCCTTAAGAAAACAGA
ATATTCAAAAACAGCACTTTTCCAGGAAGTTAGTGAGGAAGATAAGGCACACATTTATTTATAAATGGAT
GTTGCTCCTTTGTATTTTTAGCTTCCCTATTTGCTTAAAAGTACAGGCTCCCTAAGAGAGGATGGAGAGG
GAGAGACTGAATTGTTAGTAGGTCTAAACATCAAAGAAAACATTTTTATTAGTTACTTATGGAAAATCAT
CTATTACAATGATAACCTTCAAGTGACTTCCATTATGGCTGGACAGGCGGTGAGCTCAGTGGATTGCAGT
GGTGTGCTGGTGATTTTGCACAGTGAGCTCTGCGGAAGGGGTCAGGCTCAACTGCTGATGTGTCTCACAC
GTAGCAGACAAGGGGTGTCTGACTGGCTTCTTTTGCCTCAAGATGGTGTATGTCGTAAGTGATGCAATCA
GCTGTCTGCTTTTTAAGGTTGGGATTGTGCTGACTTTGGGATTAACATGAGCTTCTTTAGCAACCAAGCA
TGAACTTGATTAAGACCAGAAGTTTGGGAGATGAGTCCTGGCATTATGTCTAGGACTAAAGCAGTGGCTT
TGTATAGCAAGCTGAGTAAAGGTTGACATATTCCAAAACCCTTCTTTTTAAAATGAAAAAGGATGGAGAG
AAGGATGGAAAGCCTGGACTTAAACCTTTAGAAAAAACTTCTGGAGAGAAATCCCTTTTAAACAGTTACT
TTTGTCATTGCCTCTGGTCATTTGTCTAAATAGGAATGGAAAATTAAAAGAAAAGCAACAATCCAATCTT
TTTTCTAAAAATTATGCTGGGGTCTCGACTAAAACTGAATTTGAATTGGAAAATTCTGGTGTTGGTTGGA
GTTCCATCTTGCAAGGGATAATACAAATCCTATGATCTCTATGCCCAATATGCTGCCTCAACTCTGAGCT
GTCTGCAAGGCTTAGTAAGTATTGAGTGGTGTTTTTTTTTTCTTTTTATACAATACCATGTTAACCACAT
G

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006591.1
Synonyms P66; P68; PPP1R128
Summary This gene encodes the 66-kDa subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein plays a role in regulating the activity of DNA polymerase delta through interactions with other subunits and the processivity cofactor proliferating cell nuclear antigen (PCNA). Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
Locus ID 10714
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations

Documents