TJP1 (NM_003257) Human 3' UTR Clone

CAT#: SC214630

3`UTR clone of tight junction protein 1 (zona occludens 1) (TJP1) transcript variant 1 for miRNA target validation

Clone Modification / Custom Cloning Service

USD 526.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TJP1 (NM_003257) Human 3' UTR Clone
Vector pMirTarget
Symbol TJP1
Synonyms ZO-1
ACCN NM_003257
Insert Size 1477
Sequence Data
Insert Sequence
>SC214630 3'UTR clone of NM_003257
The sequence shown below is from the reference sequence of NM_003257. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCTCGTTGGAGCAAACTGTGTTTCTGTCCTTATTGACCACTTTTAACTCTTGAAATATAGGAACTTAAAT
AATGTGAAACTGGATTAAACTTAATCTAAATGGAACCACTCTATCAAGTATTATACCTTTTTTAGAGTTG
ATACTACAGTTTGTTAGTATGAGGCATTTGTTTGAACTGATAAAGATGAGTGAGCATGCCCCTGAACCAT
GGTCGGAAAACATGCTACACACTGCATGTTTGTGATTGACGGGACTGTTGGTATTGGCTAGAGGTTCAAA
GATATTTTGCTTTGTGATTTTTGTAATTTTTTTATCGTCACTGCTTAACTTCACATATTGATTTCCGTTA
AAATACCAGCCAGTAAATGGGGGTGCATTTGAGGTCTGTTCTTTCCAAAGTACACTGTTTCAAACTTTAC
TATGGCCCTGGCCTAGCATACGTACACATTTTATTTTATTATGCATGAAGTAATATGCACACATTTTTTA
AATGCACCTGGAATATATAACCAGTGTTGTGGATTTAACAGAAATGTACAGCAAGGAGATTTACAACTGG
GGGAGGGTGAAGTGAAGACAATGACTTACTGTACATGAAAACACATTTTTCTTAGGGAAGGATACAAAAG
CATGTGAGACTGGTTCCATGGCCTCTTCAGATCTCTAACTTCACCATATTACCACAGACATACTAACCAG
CAGAAATGCCTTACCCTCATGTTCTTAATTCTTAGCTCATTCTCCTTGTGTTACTAAGTTTTTATGGCTT
TTGTGCATTATCTAGATACTGTATCATGACAAAGACTGAGTACGTTGTGCATTTGGTGGTTTCAGAAATG
TGTTATCACCCAGAAGAAAATAGTGGTGTGATTTGGGGATATTTTTTTCTTTTCTTTTCTTTTCTTTTTT
TTTTTTTTTGACAAGGGGCAGTGGTGGTTTTCTGTTCTTTCTGGCTATGCATTTGAAAATTTTGATGTTT
TAAGGATGCTTGTACATAATGCGTGCATACCACTTTTGTTCTTGGTTTGTAAATTAACTTTTATAAACTT
TACCTTTTTTATACATAAACAAGACCACGTTTCTAAAGGCTACCTTTGTATTCTCTCCTGTACCTCTTGA
GCCTTGAACTTTGACCTCTGCAGCAATAAAGCAGCGTTTCTATGACACATGCAAGGTCATTTTTTTTAAG
AAAAAGGATGCACAGAGTTGTTACATTTTTAAGTGCTGCATTTAAAAGATACAGTTACTCAGAATTCTCT
AGTTTGATTAAATTCTTGCAAAGTATCCCTACTGTAATTTGTGATACAATGCTGTGCCCTAAAGTGTATT
TTTTTACTAATAGACAATTTATTATGGCACATCAGCACGATTTCTGTTTAGATAATACACCACTACATTC
TGTTAATCATTAGGTGTGACTGAATTTCTTTTGCCGTTATTAAAAATCTCAAATTTCTAAATCTCCAAAA
TAAAACT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003257.3
Synonyms ZO-1
Summary This gene encodes a protein located on a cytoplasmic membrane surface of intercellular tight junctions. The encoded protein may be involved in signal transduction at cell-cell junctions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Locus ID 7082
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents