MSH3 (NM_002439) Human 3' UTR Clone

CAT#: SC211522

3`UTR clone of mutS homolog 3 (E. coli) (MSH3) for miRNA target validation

Change vector?

USD 526.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MSH3 (NM_002439) Human 3' UTR Clone
Vector pMirTarget
Symbol MSH3
Synonyms DUP; FAP4; MRP1
ACCN NM_002439
Insert Size 979
Sequence Data
Insert Sequence
>SC211522 3'UTR clone of NM_002439
The sequence shown below is from the reference sequence of NM_002439. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGAGGAGTTCAACATGGAAGAAACACAGACTTCTCTTCTTCATTAAAATGAAGACTACATTTGTGAACA
AAAAATGGAGAATTAAAAATACCAACTGTACAAAATAACTCTCCAGTAACAGCCTATCTTTGTGTGACAT
GTGAGCATAAAATTATGACCATGGTATATTCCTATTGGAAACAGAGAGGTTTTTCTGAAGACAGTCTTTT
TCAAGTTTCTGTCTTCCTAACTTTTCTACGTATAAACACTCTTGAATAGACTTCCACTTTGTAATTAGAA
AATTTTATGGACAGTAAGTCCAGTAAAGCCTTAAGTGGCAGAATATAATTCCCAAGCTTTTGGAGGGTGA
TATAAAAATTTACTTGATATTTTTATTTGTTTCAGTTCAGATAATTGGCAACTGGGTGAATCTGGCAGGA
ATCTATCCATTGAACTAAAATAATTTTATTATGCAACCAGTTTATCCACCAAGAACATAAGAATTTTTTA
TAAGTAGAAAGAATTGGCCAGGCATGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCAAGGTAG
GCAGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGCAAAACCCCATCTTTACTAAAAA
TATAAAGTACATCTCTACTAAAAATACGAAAAAATTAGCTGGGCATGGTGGCGCACACCTGTAGTCCCAG
CTACTCCGGAGGCTGAGGCAGGAGAATCTCTTGAACCTGGGAGGCGGAGGTTGCAATGAGCCGAGATCAC
GTCACTGCACTCCAGCTTGGGCAACAGAGCAAGACTCCATCTCAAAAAAAAAAAAAGAAAAAAGAAAAGA
AATAGAATTATCAAGCTTTTAAAAACTAGAGCACAGAAGGAATAAGGTCATGAAATTTAAAAGGTTAAAT
ATTGTCATAGGATTAAGCAGTTTAAAGATTGTTGGATGAAATTATTTGTCATTCATTCAAGTAATAAAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002439.3
Synonyms DUP; FAP4; MRP1
Summary The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011].
Locus ID 4437
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations

Documents