SERCA2 (ATP2A2) (NM_001681) Human 3' UTR Clone

SKU
SC210032
3' UTR clone of ATPase Ca++ transporting cardiac muscle slow twitch 2 (ATP2A2) transcript variant 2 for miRNA target validation
$683.00
In Stock*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol SERCA2
Synonyms ATP2B; DAR; DD; SERCA2
ACCN NM_001681
Insert Size 786 bp
Sequence Data
Insert Sequence
>SC210032 3' UTR clone of NM_001681
The sequence shown below is from the reference sequence of NM_001681. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAACTACCTGGAACCTGCAATACTGGAGTAACCGCTTCCTAAACCATTTTGCAGAAATGTAAGGGTGTTC
GGTTGCGTGCATGTGCGTTTTTAGCAACACATCTACCAACCCTGTGCATGACTGATGTTGGGGAAAAAGA
AAAGTAAAAAACTTCCCAACTCACTTTGTGTTATGTGGAGGAAATGTGTATTACCAATGGGGTTGTTAGC
TTTTAAATCAAAATACTGATTACAGATGTACAATTTAGCTTAATCAGAAAGCCTCTCCAGAGAAGTTTGG
TTTCTTTGCTGCAAGAGGAATGAGGCTCTGTAACCTTATCTAAGAACTTGGAAGCCGTCAGCCAAGTCGC
CACATTTCTCTGCAAAATGTCATAGCTTATATAAATGTACAGTATTCAATTGTAATGCATGCCTTCGGTT
GTAAGTAGCCAGATCCCTCTCCAGTGACATTGGAACATGCTACTTTTTAATTGGCCCTGTACAGTTTGCT
TATTTATAAATTCATTAAAAACACTACAGGTGTTGAATGGTTAAAATGTAGGCCTCCAGTTCATTTTCAG
TTATTTTCTGAGTGTGCAGACAGCTATTTCGCACTGTATTAAATGTAACTTATTTAATGAAATCAGAAGC
AGTAGACAGATGTTGGTGCAATACAAATATTGTGATGCATTTATCTTAATAAAATGCTAAATGTCAATTT
ATCACTGCGCATGTTTGACTTTAGACTGTAAATAGAGATCAGTTTGTTTCTTTCTGTGCTGGTAACAATG
AGCGTCGCACAGACAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001681.3
Locus ID 488
Summary This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of the skeletal muscle. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the sarcoplasmic reticulum lumen, and is involved in regulation of the contraction/relaxation cycle. Mutations in this gene cause Darier-White disease, also known as keratosis follicularis, an autosomal dominant skin disorder characterized by loss of adhesion between epidermal cells and abnormal keratinization. Other types of mutations in this gene have been associated with various forms of muscular dystrophies. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2019]
Write Your Own Review
You're reviewing:SERCA2 (ATP2A2) (NM_001681) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.