SOD2 (NM_000636) Human 3' UTR Clone

SKU
SC209718
3' UTR clone of superoxide dismutase 2 mitochondrial (SOD2) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation
$683.00
In Stock*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol SOD2
Synonyms GClnc1; IPO-B; IPOB; Mn-SOD; MNSOD; MVCD6
ACCN NM_000636
Insert Size 802 bp
Sequence Data
Insert Sequence
>SC209718 3' UTR clone of NM_000636
The sequence shown below is from the reference sequence of NM_000636. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAGAATGTAACTGAAAGATACATGGCTTGCAAAAAGTAAACCACGATCGTTATGCTGAGTATGTTAAGC
TCTTTATGACTGTTTTTGTAGTGGTATAGAGTACTGCAGAATACAGTAAGCTGCTCTATTGTAGCATTTC
TTGATGTTGCTTAGTCACTTATTTCATAAACAACTTAATGTTCTGAATAATTTCTTACTAAACATTTTGT
TATTGGGCAAGTGATTGAAAATAGTAAATGCTTTGTGTGATTGAATCTGATTGGACATTTTCTTCAGAGA
GCTAAATTACAATTGTCATTTATAAAACCATCAAAAATATTCCATCCATATACTTTGGGGACTTGTAGGG
ATGCCTTTCTAGTCCTATTCTATTGCAGTTATAGAAAATCTAGTCTTTTGCCCCAGTTACTTAAAAATAA
AATATTAACACTTTCCCAAGGGAAACACTCGGCTTTCTATAGAAAATTGCACTTTTTGTCGAGTAATCCT
CTGCAGTGATACTTCTGGTAGATGTCACCCAGTGGTTTTTGTTAGGTCAAATGTTCCTGTATAGTTTTTG
CAAATAGAGCTGTATACTGTTTAAATGTAGCAGGTGAACTGAACTGGGGTTTGCTCACCTGCACAGTAAA
GGCAAACTTCAACAGCAAAACTGCAAAAAGGTGGTTTTTGCAGTAGGAGAAAGGAGGATGTTTATTTGCA
GGGCGCCAAGCAAGGAGAATTGGGCAGCTCATGCTTGAGACCCAATCTCCATGATGACCTACAAGCTAGA
GTATTTAAAGGCAGTGGTAAATTTCAGGAAAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000636.2
Locus ID 6648
Summary This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. [provided by RefSeq, Apr 2016]
Write Your Own Review
You're reviewing:SOD2 (NM_000636) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.