Axin 1 (AXIN1) (NM_003502) Human 3' UTR Clone

CAT#: SC209177

3' UTR clone of axin 1 (AXIN1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "Axin 1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol Axin 1
Synonyms AXIN; PPP1R49
ACCN NM_003502
Insert Size 712 bp
Sequence Data
>SC209177 3’UTR clone of NM_003502
The sequence shown below is from the reference sequence of NM_003502. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCATCGGCAAAGTGGAGAAGGTGGACTGATAGGCTGGTGGGCTGGCCGCTGTGCCAGGCGAGGCCCTT
GGCGGGCACGGGTGTCACGGCCAGGCAGATGACCTCGTACTCAGGAGCCCGATGGGGAACAGTGTTGGG
TGTACCACCCATCCCTGTGGTCTACCCGTGTCTAGAGGCAGGTAGGGGGTCCCTCCAAGTGGTCCACAA
GCTTCTGTCCTGCCCCCAAGGAGGCAGCCTGGACCACTCCTCATAGCAATACTTGGAGGGCCCAGCCCA
AGTGAGGCAGCCGAGGTCCCTGCTGCCAGCTTCAGGTGACCCCCCCCCATCCCCCGGCACCTCCCTTGG
GCACGTGTGCTGGGATCTACTTTCCCTCTGGGATTTGCCCACGTACCCAGGTCTGGGTGGGGCCCAGGC
CCGGATGCAGAGGCCTGCAGGGCCTCTGTCAATTGTACGCGCCACCGAGTGCCTTCAACACAGCTTGTC
TCTTGCCTGCCACTGTGTGAATCGGCGACGGAGCACTGCACCTGCCTCCAGCCGCCGGCTGTGCAGTCC
TGGGTCCTCCTTTCTGAGGGCCCGTGTAAATATGTACATTTCTCAGGCTAGGCCAGCAGGGGCTGCCCG
AGTCTGTTTTTCATGCGATGACACTTGTACAATTAATTATCTTTTCAAAGGTACTTGGATAATAATGAA
ATAAAACTGTTTTTGAACCTGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003502.4
Summary This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Locus ID 8312
MW 25.1

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.