Catalase (CAT) (NM_001752) Human 3' UTR Clone

SKU
SC208265
3' UTR clone of catalase (CAT) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Catalase
ACCN NM_001752
Insert Size 644 bp
Sequence Data
Insert Sequence
>SC208265 3' UTR clone of NM_001752
The sequence shown below is from the reference sequence of NM_001752. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAGAAGGCAAATCTGTGAGGCCGGGGCCCTGCACCTGTGCAGCGAAGCTTAGCGTTCATCCGTGTAACC
CGCTCATCACTGGATGAAGATTCTCCTGTGCTAGATGTGCAAATGCAAGCTAGTGGCTTCAAAATAGAGA
ATCCCACTTTCTATAGCAGATTGTGTAACAATTTTAATGCTATTTCCCCAGGGGAAAATGAAGGTTAGGA
TTTAACAGTCATTTAAAAAAAAAATTTGTTTTGACGGATGATTGGATTATTCATTTAAAATGATTAGAAG
GCAAGTTTCTAGCTAGAAATATGATTTTATTTGACAAAATTTGTTGAAATTATGTATGTTTACATATCAC
CTCATGGCCTATTATATTAAAATATGGCTATAAATATATAAAAAGAAAAGATAAAGATGATCTACTCAGA
AATTTTTATTTTTCTAAGGTTCTCATAGGAAAAGTACATTTAATACAGCAGTGTCATCAGAAGATAACTT
GAGCACCGTCATGGCTTAATGTTTATTCCTGATAATAATTGATCAAATTCATTTTTTTCACTGGAGTTAC
ATTAATGTTAATTCAGCACTGATTTCACAACAGATCAATTTGTAATTGCTTACATTTTTACAATAAATAA
TCTGTACGTAAGAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001752.3
Locus ID 847
Summary This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009]
Write Your Own Review
You're reviewing:Catalase (CAT) (NM_001752) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.