MTA1 (NM_004689) Human 3' UTR Clone

CAT#: SC207007

3' UTR clone of metastasis associated 1 (MTA1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MTA1
• ACCN: NM_004689
• Insert Size: 544 bp
• Sequence Data:
  Insert Sequence

  >SC207007 3’UTR clone of NM_004689
  The sequence shown below is from the reference sequence of NM_004689. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  AACGACGAGCCCATCGTCATCGAGGACTAGGGGCCGCCCCCACCTGCGGCCGCCCCCCGCCCCTCGCCC
  GCCCACACGGCCCCTTCCCAGCCAGCCCGCCGCCCGCCCCTCAGTTTGGTAGTGCCCCACCTCCCGCCC
  TCACCTGCAGAGAAACGCGCTCCTTGGCGGACACTGGGGGAGGAGAGGAAGAAGCGCGGCTAACTTATT
  CCGAGAATGCCGAGGAGTTGTCGTTTTTAGCTTTGTGTTTACTTTTTGGCTGGAGCGGAGATGAGGGGC
  CACCCCGTGCCCCTGTGCTGCGGGGCCTTTTGCCCGGAGGCCGGGCCCTAAGGTTTTGTTGTGTTCTGT
  TGAAGGTGCCATTTTAAATTTTATTTTTATTACTTTTTTTGTAGATGAACTTGAGCTCTGTAACTTACA
  CCTGGAATGTTAGGATCGTGCGGCCGCGGCCGGCCGAGCTGCCTGGCGGGGTTGGCCCTTGTCTTTTCA
  AGTAATTTTCATATTAAACAAAAACAAAGAAAAAAAATCTTATAAAAAGGAAAAAAACCAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004689.4
• Summary: This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
• Locus ID: 9112
• MW: 20.1