MTA1 (NM_004689) Human 3' UTR Clone

SKU
SC207007
3' UTR clone of metastasis associated 1 (MTA1) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol MTA1
ACCN NM_004689
Insert Size 544 bp
Sequence Data
Insert Sequence
>SC207007 3’UTR clone of NM_004689
The sequence shown below is from the reference sequence of NM_004689. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACGACGAGCCCATCGTCATCGAGGACTAGGGGCCGCCCCCACCTGCGGCCGCCCCCCGCCCCTCGCCC
GCCCACACGGCCCCTTCCCAGCCAGCCCGCCGCCCGCCCCTCAGTTTGGTAGTGCCCCACCTCCCGCCC
TCACCTGCAGAGAAACGCGCTCCTTGGCGGACACTGGGGGAGGAGAGGAAGAAGCGCGGCTAACTTATT
CCGAGAATGCCGAGGAGTTGTCGTTTTTAGCTTTGTGTTTACTTTTTGGCTGGAGCGGAGATGAGGGGC
CACCCCGTGCCCCTGTGCTGCGGGGCCTTTTGCCCGGAGGCCGGGCCCTAAGGTTTTGTTGTGTTCTGT
TGAAGGTGCCATTTTAAATTTTATTTTTATTACTTTTTTTGTAGATGAACTTGAGCTCTGTAACTTACA
CCTGGAATGTTAGGATCGTGCGGCCGCGGCCGGCCGAGCTGCCTGGCGGGGTTGGCCCTTGTCTTTTCA
AGTAATTTTCATATTAAACAAAAACAAAGAAAAAAAATCTTATAAAAAGGAAAAAAACCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004689.4
Locus ID 9112
Summary This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Write Your Own Review
You're reviewing:MTA1 (NM_004689) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.