ADFP (PLIN2) (NM_001122) Human 3' UTR Clone

SKU
SC206962
3' UTR clone of perilipin 2 (PLIN2) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ADFP
Synonyms ADFP; ADRP
ACCN NM_001122
Insert Size 517 bp
Sequence Data
Insert Sequence
>SC206962 3’UTR clone of NM_001122
The sequence shown below is from the reference sequence of NM_001122. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCCAGCGATCTGAGCATAAAACTCATTAAACCTGCCCCTATCACTAGTGCATGCTGTGGCCAGACAGA
TGACACCTTTTGTTATGTTGAAATTAACTTGCTAGGCAACCCTAAATTGGGAAGCAAGTAGCTAGTATA
AAGGCCCTCAATTGTAGTTGTTTCCAGCTGAATTAAGAGCTTTAAAGTTTCTGGCATTAGCAGATGATT
TCTGTTCACCTGGTAAGAAAAGAATGATAGGCTTGTCAGAGCCTATAGCCAGAACTCAGAAAAAATTCA
AATGCACTTATGTTCTCATTCTATGGCCATTGTGTTGCCTCTGTTACTGTTTGTATTGAATAAAAACAT
CTTCATGTGGGCTGGGGTAGAAACTGGTGTCTGCTCTGGTGTGATCTGAAAAGGCGTCTTCACTGCTTT
ATCTCATGATGCTTGCTTGTAAAACTTGATTTTAGTTTTTCATTTCTCAAATAGGAATACTACCTTTGA
ATTCAATAAAATTCACTGCAGGATAGACCAGTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001122.4
Locus ID 123
Summary The protein encoded by this gene belongs to the perilipin family, members of which coat intracellular lipid storage droplets. This protein is associated with the lipid globule surface membrane material, and maybe involved in development and maintenance of adipose tissue. However, it is not restricted to adipocytes as previously thought, but is found in a wide range of cultured cell lines, including fibroblasts, endothelial and epithelial cells, and tissues, such as lactating mammary gland, adrenal cortex, Sertoli and Leydig cells, and hepatocytes in alcoholic liver cirrhosis, suggesting that it may serve as a marker of lipid accumulation in diverse cell types and diseases. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
Write Your Own Review
You're reviewing:ADFP (PLIN2) (NM_001122) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.