UBR4 (NM_020765) Human 3' UTR Clone

SKU
SC204323
3' UTR clone of ubiquitin protein ligase E3 component n-recognin 4 (UBR4) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol UBR4
Synonyms p600; RBAF600; ZUBR1
ACCN NM_020765
Insert Size 352 bp
Sequence Data
Insert Sequence
>SC204323 3’UTR clone of NM_020765
The sequence shown below is from the reference sequence of NM_020765. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGAAGGACCTGTTGAACTCAGTCCCCTGACCACCACACAGCAGCTGCGGCGGCGAAGACGAAGCTGGC
TTGCCTTCCACCCTCTGTTCTCCCTCCTTGTGCATTAAGTTCCCTCCGCGGGATGCTGCATTGTTACCC
CGCCCTCCCCTCTCTCATTTTTCTTGGTGTGGCTTGGGGTTTTTAGGCTTCCTGTTTTATCTCGTGTGT
GTGGTGCACCAGCTATGAGGTTGTCTGTAACCCAAGCCATCAAAGGGCCTGTACATACCTAGGAGCCAT
GAGTTGTCCCGGCCAGCTTCATACTTGAGTGTGCACATCTTGAGAAATAAACAAGTGACTTAACACACA
TTGAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020765.3
Locus ID 23352
Summary The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
Write Your Own Review
You're reviewing:UBR4 (NM_020765) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.