PPP1R14B (NM_138689) Human 3' UTR Clone

SKU
SC204307
3' UTR clone of protein phosphatase 1 regulatory (inhibitor) subunit 14B (PPP1R14B) for miRNA target validation
$683.00
In Stock*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol PPP1R14B
Synonyms PHI-1; PLCB3N; PNG; SOM172
ACCN NM_138689
Insert Size 304 bp
Sequence Data
Insert Sequence
>SC204307 3' UTR clone of NM_138689
The sequence shown below is from the reference sequence of NM_138689. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CATGCAGAAGCTGAGCACACCCCAGAAGAAGTGACGGTCCCCGACCCAGGAGAACGGTGGCTCCCACAGG
ACAATCGCTGCCCCCCAACCTCGTAGCAACAGCAATACCGGGGGACCCTGCGGCCAGGCCTGGTGCCATG
AGCAGGGCTCCTCGTGCCCCTGGCCCAGGGGTCTCTTCCCCTGCCCCCTCAGTTTTCCACTTTTGGGGTT
TTTTATTGTTATTAAACTGATGGGACTTTTTGTGTTTTTATATTGACTCTGCGGCGCGGGCCCTTTAATA
AAGCTAGGATACGCCTTTGGTGCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138689.2
Locus ID 26472
Summary Inhibitor of PPP1CA. Has over 50-fold higher inhibitory activity when phosphorylated (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:PPP1R14B (NM_138689) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.