MAD1 (MAD1L1) (NM_001013836) Human 3' UTR Clone

SKU
SC203834
3' UTR clone of MAD1 mitotic arrest deficient-like 1 (yeast) (MAD1L1) transcript variant 2 for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol MAD1
Synonyms MAD1; PIG9; TP53I9; TXBP181
ACCN NM_001013836
Insert Size 305 bp
Sequence Data
Insert Sequence
>SC203834 3’UTR clone of NM_001013836
The sequence shown below is from the reference sequence of NM_001013836. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGCTCTTCAGCCGCCAGACCGTGGCGTAGCCTGCAGGCTCGGGGGCATAGCCGGAGCCACTCTGCTTG
GCCTGACCTGCAGGTCCCCTGCCCCGCCAGCCACAGGCTGGGTGCACGTCCTGCCTCTCCAGCCCCACA
GGGCAGCAGCATGACTGACAGACACGCTGGGACCTACGTCGGGCTTCCTGCTGGGGCGGCCAGCACCCT
CTCCACGTGCAGACCCCATGCGTCCCGGAGCCTGGTGTGTGGGCGTCGGCCACCAGCCTGGGTTCCTCA
CCTTGTGAAATAAAATCTTCTCCCCTAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001013836.2
Locus ID 8379
Summary MAD1L1 is a component of the mitotic spindle-assembly checkpoint that prevents the onset of anaphase until all chromosome are properly aligned at the metaphase plate. MAD1L1 functions as a homodimer and interacts with MAD2L1. MAD1L1 may play a role in cell cycle control and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Write Your Own Review
You're reviewing:MAD1 (MAD1L1) (NM_001013836) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.