OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

EZH2 (NM_004456) Human 3' UTR Clone

Be the first to review this product
SKU
SC203485
3' UTR clone of enhancer of zeste homolog 2 (Drosophila) (EZH2) transcript variant 1 for miRNA target validation
  $683.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PR300001 Firefly luciferase assay kit, 150 assays
1 kit
$235.00

Other products for "EZH2 or NM_004456"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol EZH2
Synonyms ENX-1; ENX1; EZH2b; KMT6; KMT6A; WVS; WVS2
ACCN NM_004456
Insert Size 283 bp
Sequence Data
Insert Sequence
>SC203485 3' UTR clone of NM_004456
The sequence shown below is from the reference sequence of NM_004456. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGCCCTGAAGTATGTCGGCATCGAAAGAGAAATGGAAATCCCTTGACATCTGCTACCTCCTCCCCCCTC
CTCTGAAACAGCTGCCTTAGCTTCAGGAACCTCGAGTACTGTGGGCAATTTAGAAAAAGAACATGCAGTT
TGAAATTCTGAATTTGCAAAGTACTGTAAGAATAATTTATAGTAATGAGTTTAAAAATCAACTTTTTATT
GCCTTCTCACCAGCTGCAAAGTGTTTTGTACCAGTGAATTTTTGCAATAATGCAGTATGGTACATTTTTC
AAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004456.3
Locus ID 2146
Summary This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. provided by RefSeq, Feb 2011
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

MicroRNA-365 targets multiple oncogenes to inhibit proliferation, invasion, and self-renewal of aggressive endometrial cancer cells
Wang, Su, Zhang et al
Cancer Manag Res (2018) 10, 5171-5185 DOI: 10.2147/CMAR.S174889
AI Summary: In this study, OriGene products including EZH2 (Cat# SC11973) and FOS (Cat# SC11743) expression plasmids were used to investigate and validate the role of these genes as direct targets of miR-365 in endometrial cancer cells.
FigureFigureFigure
The polycomb group protein EZH2 inhibits lung cancer cell growth by repressing the transcription factor Nrf2
Li, Xu, Tang et al
FEBS Lett. (2014)
Cited by 61
AI Summary: OriGene products contributed to this study by providing primers for EZH2 (NM_004456), Nrf2 (NM_006164), NQO-1 (NM_000903), and HO-1 (NM_002133), which were used for gene expression analysis.
Snippet: Applied Biosystems). The EZH2 primers (NM_004456), Nrf2 primers (NM_006164), NQO-1 primers (NM_000903), and HO-1 primers (NM_002133) were purchased from OriGene Technology. 2.4. Western blot. Tissues and lung ... Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products