Laminin (LAMA1) (NM_005559) Human 3' UTR Clone

SKU
SC202358
3' UTR clone of laminin alpha 1 (LAMA1) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Laminin
Synonyms LAMA; PTBHS; S-LAM-alpha
ACCN NM_005559
Insert Size 367 bp
Sequence Data
Insert Sequence
>SC202358 3’UTR clone of NM_005559
The sequence shown below is from the reference sequence of NM_005559. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTTCATTCCTGTCCTGGGACCGAGTCCTGAACTTCAAGCAGAATCCTCAGTTGGAATCATTGCTAATAT
TTTGAGGAGAAGTGTATGTGTGAATTAAGAATCTCTTCAGTTCATATTTCATTTCCAACTCAGGTTAAG
TGTTTCTGGGGAGAGATGTTGTGTTTACGTTACACTAAAACCACATGTGCAACAAATACCTCCATTAAA
TGGTCTAAAATGTAAATTGAATTCCCTGGCTCTCTTTTTAAACGTATTTTTAAAAAAATCTTTATACAC
ATTGAATGTTCTGTTGATTACTTGATAGTATTTTATGTTTTTCATTTTGAGCTTTTTAAAAAAGTATCA
ATACAGATGATAACAGATCAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005559.4
Locus ID 284217
Summary This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
Write Your Own Review
You're reviewing:Laminin (LAMA1) (NM_005559) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.