ERK2 (MAPK1) (NM_138957) Human 3' UTR Clone

SKU
SC201852
3' UTR clone of mitogen-activated protein kinase 1 (MAPK1) transcript variant 2 for miRNA target validation
$683.00
In Stock*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ERK2
Synonyms ERK; ERK-2; ERK2; ERT1; MAPK2; NS13; p38; p40; p41; p41mapk; p42-MAPK; P42MAPK; PRKM1; PRKM2
ACCN NM_138957
Insert Size 205 bp
Sequence Data
Insert Sequence
>SC201852 3' UTR clone of NM_138957
The sequence shown below is from the reference sequence of NM_138957. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGACTGCTAGATTCCAGCCAGGATACAGATCTTAAATTTGTCAGGTACCTGGAGTTTAATACAGTGAGC
TCTAGCAAGGGAGGCGCTGCCTTTTGTTTCTAGAATATTATGTTCCTCAAGGTCCATTATTTTGTATTCT
TTTCCAAGCTCCTTATTGGAAGGTATTTTTTTAAATTTAGAATTAAAAATTATTTAGAAAGTTAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138957.2
Locus ID 5594
Summary This gene encodes a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The activation of this kinase requires its phosphorylation by upstream kinases. Upon activation, this kinase translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. One study also suggests that this protein acts as a transcriptional repressor independent of its kinase activity. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Two alternatively spliced transcript variants encoding the same protein, but differing in the UTRs, have been reported for this gene. [provided by RefSeq, Jan 2014]
Write Your Own Review
You're reviewing:ERK2 (MAPK1) (NM_138957) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.