Leukotriene A4 hydrolase (LTA4H) (NM_000895) Human 3' UTR Clone

SKU
SC201507
3' UTR clone of leukotriene A4 hydrolase (LTA4H) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Leukotriene A4 hydrolase
ACCN NM_000895
Insert Size 266 bp
Sequence Data
Insert Sequence
>SC201507 3’UTR clone of NM_000895
The sequence shown below is from the reference sequence of NM_000895. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGTGGGGAAAGACTTAAAAGTGGATTAAAGACCTGCGTATTGATGATTTTAGAGATTTCTCTTTTTT
AAATGGAATTCGTAAAGAAATATAAAACTTCAGCTCACAATTAAAACTGTCTTTTTAGTTTTGGCTTTT
TATTGTTTTGTTGGTGATTTTACTGAAATAAAGTTGAGCTACTTCTTCTTATAGTGGCATATTCTTTGT
AAATTTTAACAAGGTTTAATCTTTTGATTTACAAATTAAAAAATTTTGAATTAGCTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000895.3
Locus ID 4048
Summary The protein encoded by this gene is an enzyme that contains both hydrolase and aminopeptidase activities. The hydrolase activity is used in the final step of the biosynthesis of leukotriene B4, a proinflammatory mediator. The aminopeptidase activity has been shown to degrade proline-glycine-proline (PGP), a neutrophil chemoattractant and biomarker for chronic obstructive pulmonary disease (COPD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Write Your Own Review
You're reviewing:Leukotriene A4 hydrolase (LTA4H) (NM_000895) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.