OriGene Logo

Fluorescent Protein Antibodies

Items 1-25 of 50

sort-ascending
  • Immunoblot analysis of four different Myc-DDK tagged over-expression lysates and one Empty vector transfected 293T cells with TA150121 at 1:500.
    In Stock*
    $848.00
    TA150121-1 - 9E10, Anti-Myc Monoclonal Antibody
    9E10, Anti-Myc Monoclonal Antibody
    TA150121-1 is a replacement of SM1863P.
    Applications FC, IF, IP, WB
    Conjugation Unconjugated
    Immunogen AEEQKLISEEDLLRKRREQLKHKLE conjugated to KLH, corresponding to C terminal amino acids 408-432 of human c-Myc
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (left lane) or pCMV6-ENTRY tYFP (right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-tYFP (TA150028).
    In Stock*
    $447.00
    TA150028 - Mouse monoclonal turboYFP antibody, clone OTI14C4
    Mouse monoclonal turboYFP antibody, clone OTI14C4
    Applications FC, IF, WB
    Conjugation Unconjugated
    Immunogen Full length tYFP protein expressed in HEK293T cells
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (Left lane) or pCMV6-ENTRY mGFP (Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-mGFP/mCFP/mYFP/KillerRed (TA180076, 1:500).
    In Stock*
    $447.00
    TA180076 - Mouse monoclonal mGFP/mCFP/mYFP/KillerRed antibody, clone OTI2F6
    Mouse monoclonal mGFP/mCFP/mYFP/KillerRed antibody, clone OTI2F6
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of mGFP expressed in HEK293 cells. It recognizes mGFP, mCFP, mYFP and KillerRed proteins.
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (Left lane) or pCMV6-ENTRY tdTomato (Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-tdTomato (TA180009, 1:2000).
    In Stock*
    $447.00
    TA180009 - Mouse monoclonal tdTomato antibody, clone OTI2H2
    Mouse monoclonal tdTomato antibody, clone OTI2H2
    Applications WB
    Conjugation Unconjugated
    Immunogen A tdTomato tagged recombinant protein expressed in HEK293T cell.
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (Left lane) or pCMV6-ENTRY Dendra2 (Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-Dendra2 (TA180094, 1:500).
    In Stock*
    $447.00
    TA180094 - Mouse monoclonal Dendra2 antibody, clone OTI1G6
    Mouse monoclonal Dendra2 antibody, clone OTI1G6
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of Dendra2 expressed in HEK293 cells.
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6- ENTRY tdTomato cDNA and the cell lysates were collected after 48 hours. 0ug, 0.1ug, 0.5ug, 1ug of lysates (lane 1 to lane 4 respectively) were separated by SDS-PAGE and immunoblotted with Rabbit tdTomato polyclonal antibody (TA150128) at 1:10000
    In Stock*
    $377.00
    TA150128 - Rabbit Polyclonal tdTomato Antibody
    Rabbit Polyclonal tdTomato Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen tdTomato
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (Left lane) or pCMV6-ENTRY ZsGreen1 (Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-ZsGreen1 (TA180002, 1:2000).
    In Stock*
    $447.00
    TA180002 - Mouse monoclonal ZsGreen1 antibody, clone OTI2C2
    Mouse monoclonal ZsGreen1 antibody, clone OTI2C2
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of ZsGreen1 expressed in HEK293 cells.
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (left lane) or pCMV6-ENTRY eGFP (right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immuno-blotted with 5A2 anti-eGFP monoclonal antibody (TA150052) (1:2000).
    In Stock*
    $447.00
    TA150052 - Mouse monoclonal eGFP antibody, clone OTI5A2
    Mouse monoclonal eGFP antibody, clone OTI5A2
    Applications WB
    Conjugation Unconjugated
    Immunogen A full length eGFP tagged recombinant protein expressed in HEK293T cell
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY turboGFP (left lane) cDNA or pCMV6-ENTRY control (right lane) for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immuno-blotted with Rabbit anti-turboGFP polyclonal antibody (TA150071) (1:2000).
    In Stock*
    $377.00
    TA150071 - Rabbit Polyclonal turboGFP Antibody
    Rabbit Polyclonal turboGFP Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen Purified tGFP protein expressed in E. coli.
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY turboGFP (left lane) cDNA or pCMV6-ENTRY control (right lane) for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immuno-blotted with Chicken anti-turboGFP polyclonal antibody (TA150075) (1:3000).
    In Stock*
    $377.00
    TA150075 - Chicken Polyclonal turboGFP Antibody
    Chicken Polyclonal turboGFP Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen Purified tGFP protein expressed in E. coli.
    • Product Brand Image
  • Anti-tRFP immunoblot analysis of HEK293T over-expression lysates containing recombinant tRFP, TurboFP602 TurboFP635 fluorescence proteins at 1:2000 dilution.
    In Stock*
    $447.00
    TA150061 - Mouse monoclonal turboRFP antibody, clone OTI2D9
    Mouse monoclonal turboRFP antibody, clone OTI2D9
    Applications WB
    Conjugation Unconjugated
    Immunogen recombinant tRFP produced in E.coil
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY mCherry cDNA and the cell lysates were collected after 48 hours. 0ug, 0.1ug, 0.2ug, 0.4ug, 0.8ug, 1.6ug of lysates (lane 1 to lane 6 respectively) were separated by SDS-PAGE and immunoblotted with Rabbit mCherry polyclonal antibody (TA150125) at 1:10000.
    In Stock*
    $377.00
    TA150125 - Rabbit Polyclonal mCherry Antibody
    Rabbit Polyclonal mCherry Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen mCherry
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (Left lane) or pCMV6-ENTRY mRFP (Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-mRFP (TA180091, 1:500).
    In Stock*
    $447.00
    TA180091 - Mouse monoclonal mKate antibody, clone OTI1G5
    Mouse monoclonal mKate antibody, clone OTI1G5
    Applications WB
    Conjugation Unconjugated
    Immunogen A mRFP tagged recombinant protein expressed in HEK293T cell.
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY mKate (left lane) cDNA or pCMV6-ENTRY control (right lane) for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immuno-blotted with Rabbit anti-mKate polyclonal antibody (TA150072) (1:2000).
    In Stock*
    $377.00
    TA150072 - Rabbit Polyclonal mKate Antibody
    Rabbit Polyclonal mKate Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen Purified mKate protein expressed in E. coli.
    • Product Brand Image
  • Hela cells transiently transfected with Paxillin-GFP (RG225997) were detached and seeded onto 0.2% gelatin coated coverslip. After 24 hours incubation, the cells were fixed with 4% formaldehyde for 30 min, permeabilized with 0.1% trixon-X100, and then stained with Dylight594-labeled tGFP antibodies (TA150024) and DAPI for nucleus counter staining. (a: Paxillin-GFP; b: anti-tGFP-DyLight594; c: Merged)
    In Stock*
    $447.00
    TA150024 - Mouse monoclonal tGFP antibody (clone OTI2H8), DyLight 594 conjugated
    Mouse monoclonal tGFP antibody (clone OTI2H8), DyLight 594 conjugated
    Applications IF
    Conjugation DyLight 594
    Immunogen Anti-tGFP monoclonal antibody was produced by immunizing mice with purified tGFP protein expressed in HEK293T cell.
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (Left lane) or pCMV6-ENTRY mCherry (Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-mCherry (TA180028, 1:2000).
    In Stock*
    $447.00
    TA180028 - Mouse monoclonal mCherry antibody, clone OTI10G6
    Mouse monoclonal mCherry antibody, clone OTI10G6
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of mCherry expressed in HEK293 cells.
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (left lane) or pCMV6-ENTRY tYFP (right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-tYFP (TA150027).
    In Stock*
    $447.00
    TA150027 - Mouse monoclonal turboYFP antibody, clone OTI10F11
    Mouse monoclonal turboYFP antibody, clone OTI10F11
    Applications FC, IF, WB
    Conjugation Unconjugated
    Immunogen Full length tYFP protein expressed in HEK293T cells
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY mCherry cDNA and the cell lysates were collected after 48 hours. 0ug, 0.5ug, 1ug, 2ug, 4ug, 8ug of lysates (lane 1 to lane 6 respectively) were separated by SDS-PAGE and immunoblotted with Chicken mCherry polyclonal antibody (TA150127) at 1:5000.
    In Stock*
    $377.00
    TA150127 - Chicken Polyclonal mCherry Antibody
    Chicken Polyclonal mCherry Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen mCherry
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY mCherry cDNA and the cell lysates were collected after 48 hours. 0ug, 0.5ug, 1ug, 2ug, 4ug, 8ug of lysates (lane 1 to lane 6 respectively) were separated by SDS-PAGE and immunoblotted with Goat mCherry polyclonal antibody (TA150126) at 1:5000.
    In Stock*
    $377.00
    TA150126 - Goat Polyclonal mCherry Antibody
    Goat Polyclonal mCherry Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen mCherry
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (Left lane) or pCMV6-ENTRY mOrange (Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-mOrange/mOrange2 (TA180053, 1:2000).
    In Stock*
    $447.00
    TA180053 - Mouse monoclonal mOrange/mOrange2 antibody, clone OTI4E10
    Mouse monoclonal mOrange/mOrange2 antibody, clone OTI4E10
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of mOrange expressed in HEK293 cells. It recognizes both mOrange and mOrange2 proteins.
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (Left lane) or pCMV6-ENTRY eCFP (Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-eCFP (TA180069, 1:2000).
    In Stock*
    $447.00
    TA180069 - Mouse monoclonal eCFP antibody, clone OTI8A6
    Mouse monoclonal eCFP antibody, clone OTI8A6
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of eCFP expressed in HEK293 cells.
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (Left lane) or pCMV6-ENTRY mRFP (Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-mRFP (TA180093, 1:2000).
    In Stock*
    $447.00
    TA180093 - Mouse monoclonal mRFP antibody, clone OTI3D7
    Mouse monoclonal mRFP antibody, clone OTI3D7
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody was raised against the recombinant protein of mRFP (PS100049) expressed in HEK293 cells. Immunogen sequence: ATGGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAACATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGGCAGCAGAACCTTCATCAACCACACCCAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGGAGGCCAACACCGAGATGCTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAAGCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAACTTCAAGACCACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTCTACTATGTGGACCACAGACTGGAAAGAATCAAGGAGGCCGACAAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAAACTTAAT
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY mGFP cDNA and the cell lysates were collected after 48 hours. 0ug, 0.1ug, 0.2ug, 0.4ug, 0.8ug, 1.6ug of lysates (lane 1 to lane 6 respectively) were separated by SDS-PAGE and immunoblotted with Rabbit mGFP polyclonal antibody (TA150122) at 1:5000.
    In Stock*
    $377.00
    TA150122 - Rabbit Polyclonal mGFP Antibody
    Rabbit Polyclonal mGFP Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen mGFP
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY control (Left lane) or pCMV6-ENTRY AcGFP1 (Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-AcGFP1/PS-CFP2 (TA180011, 1:2000).
    In Stock*
    $447.00
    TA180011 - Mouse monoclonal AcGFP1/PS-CFP2 antibody, clone OTI4G4
    Mouse monoclonal AcGFP1/PS-CFP2 antibody, clone OTI4G4
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of PS-CFP2 expressed in HEK293 cells. It recognizes both PS-CFP2 and AcGFP1 proteins.
    • Product Brand Image
  • HEK293T cells were transfected with the pCMV6-ENTRY tdTomato cDNA and the cell lysates were collected after 48 hours. 0ug, 0.5ug, 1ug, 2ug, 4ug, 8ug of lysates (lane 1 to lane 6 respectively) were separated by SDS-PAGE and immunoblotted with Goat tdTomato polyclonal antibody (TA150129) at 1:5000.
    2 Weeks*
    $377.00
    TA150129 - Goat Polyclonal tdTomato Antibody
    Goat Polyclonal tdTomato Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen tdTomato
    • Product Brand Image

Items 1-25 of 50