Fluorescent Protein Antibodies

  1. Product Type

  2. Clonality

  3. Reactivity

  4. Application

View as List Grid

Items 1-25 of 50

Set Descending Direction
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal tdTomato antibody, clone OTI2H2
    Applications WB
    Conjugation Unconjugated
    Immunogen A tdTomato tagged recombinant protein expressed in HEK293T cell.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal Dendra2 antibody, clone OTI1G6
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of Dendra2 expressed in HEK293 cells.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal ZsGreen1 antibody, clone OTI2C2
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of ZsGreen1 expressed in HEK293 cells.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Rabbit Polyclonal turboGFP Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen Purified tGFP protein expressed in E. coli.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal turboYFP antibody, clone OTI14C4
    Applications FC, IF, WB
    Conjugation Unconjugated
    Immunogen Full length tYFP protein expressed in HEK293T cells
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal mGFP/mCFP/mYFP/KillerRed antibody, clone OTI2F6
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of mGFP expressed in HEK293 cells. It recognizes mGFP, mCFP, mYFP and KillerRed proteins.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal turboRFP antibody, clone OTI2D9
    Applications WB
    Conjugation Unconjugated
    Immunogen recombinant tRFP produced in E.coil
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal eGFP antibody, clone OTI5A2
    Applications WB
    Conjugation Unconjugated
    Immunogen A full length eGFP tagged recombinant protein expressed in HEK293T cell
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Rabbit Polyclonal mKate Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen Purified mKate protein expressed in E. coli.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Chicken Polyclonal turboGFP Antibody
    Applications WB
    Conjugation Unconjugated
    Immunogen Purified tGFP protein expressed in E. coli.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal mKate antibody, clone OTI1G5
    Applications WB
    Conjugation Unconjugated
    Immunogen A mRFP tagged recombinant protein expressed in HEK293T cell.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal tGFP antibody (clone OTI2H8), DyLight 594 conjugated
    Applications IF
    Conjugation DyLight 594
    Immunogen Anti-tGFP monoclonal antibody was produced by immunizing mice with purified tGFP protein expressed in HEK293T cell.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal mCherry antibody, clone OTI10G6
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of mCherry expressed in HEK293 cells.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    9E10, Anti-Myc Monoclonal Antibody
    Applications FC, IF, IP, WB
    Conjugation Unconjugated
    Immunogen AEEQKLISEEDLLRKRREQLKHKLE conjugated to KLH, corresponding to C terminal amino acids 408-432 of human c-Myc
    TA150121-1 is a replacement of SM1863P.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal eCFP antibody, clone OTI8A6
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of eCFP expressed in HEK293 cells.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal mRFP antibody, clone OTI3D7
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody was raised against the recombinant protein of mRFP (PS100049) expressed in HEK293 cells. Immunogen sequence: ATGGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAACATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGGCAGCAGAACCTTCATCAACCACACCCAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGGAGGCCAACACCGAGATGCTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAAGCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAACTTCAAGACCACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTCTACTATGTGGACCACAGACTGGAAAGAATCAAGGAGGCCGACAAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAAACTTAAT
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal AcGFP1/PS-CFP2 antibody, clone OTI4G4
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of PS-CFP2 expressed in HEK293 cells. It recognizes both PS-CFP2 and AcGFP1 proteins.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal mOrange/mOrange2 antibody, clone OTI4E10
    Applications WB
    Conjugation Unconjugated
    Immunogen This antibody is raised against a recombinant protein of mOrange expressed in HEK293 cells. It recognizes both mOrange and mOrange2 proteins.
    • TrueMAB

      Antibodies made against full-length proteins as antigens.

      Click here to learn more.

    Mouse monoclonal ZsYellow1 antibody, clone OTI3C4
    Applications WB
    Conjugation Unconjugated
    Immunogen A ZsYellow1 tagged recombinant protein expressed in HEK293T cell.
Page
per page