MIR145 Human MicroRNA Expression Plasmid (MI0000461)

CAT#: SC400175

Expression plasmid for human microRNA MIR145

USD 340.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Species Human
Vector pCMV-MIR
Sequence Data
Precursor:
CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU
Mature Sequence:
GUCCAGUUUUCCCAGGAAUCCCU

Full insert
>MI0000461 CCAGGCTAGGAACTGAATGGTTGGTTTAAATCCACCCCTCTGGCAGGAGACTGGGGAATACACATGAGCCGTGCAGACAGCAGAGGGCAGTCCTGGGGGTGGGGGCGCCAGAGGGTTTCCGGTACTTTTCAGGGCAATTGAAGTTCCGGTCACTACTCCCCCCCAGAGCAATAAGCCACATCCGGCGACGTGTGGCACCCCACCCTGGCTGCTACAGATGGGGCTGGATGCAGAAGAGAACTCCAGCTGGTCCTTAGGGACACGGCGGCCTTGGCGCTGAAGGCCACTCGCTCCCACCTTGTCCTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAAGATGGGGATTCCTGGAAATACTGTTCTTGAGGTCATGGTTTCACAGCTGGATTTGCCTCCTTCCCACCCCACAGTTGCCCCCCAATGGGGCCTCGGCTGGCTCACAGGATGAGGGTTCAAGAAGAAGGCTGTCCCTGGAGGTAAGAGGGCTTATGAACCATGTTCCAAACCTTTGCGTTGCTTTTCTTTCCATCGTGTCTATTTCATAACATCCCTGTGAGGCTGGATGTGGGAACTTCAGCACTGCCGTACTCTTGGGAAATTTGTCCAAGGCCACCCGGCTGAGCAGCGGTTGAACCAGGACACCATCAGGCATGCGTTTCTTGTCTCCACCA
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA
Antibiotic Selection Neomycin and Kanamycin
Product Components The plasmid is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
Reference Data
RefSeq MI0000461
Synonyms MIRN145 miR-145 miRNA145
Locus ID 406937
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations