Activin Receptor Type IIA (ACVR2A) (NM_001278580) Human Untagged Clone

CAT#: SC335911

ACVR2A (untagged) - Human activin A receptor, type IIA (ACVR2A), transcript variant 3


  "NM_001278580" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
ACVR2A mouse monoclonal antibody,clone OTI1F2
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Activin Receptor Type IIA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Activin Receptor Type IIA
Synonyms ACTRII; ACVR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335911 representing NM_001278580.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGTAATGAAAAGTTTTCTTATTTTCCGGAGATGGAAGTCACACAGCCCACTTCAAATCCAGTTACA
CCTAAGCCACCCTATTACAACATCCTGCTCTATTCCTTGGTGCCACTTATGTTAATTGCGGGGATTGTC
ATTTGTGCATTTTGGGTGTACAGGCATCACAAGATGGCCTACCCTCCTGTACTTGTTCCAACTCAAGAC
CCAGGACCACCCCCACCTTCTCCATTACTAGGTTTGAAACCACTGCAGTTATTAGAAGTGAAAGCAAGG
GGAAGATTTGGTTGTGTCTGGAAAGCCCAGTTGCTTAACGAATATGTGGCTGTCAAAATATTTCCAATA
CAGGACAAACAGTCATGGCAAAATGAATACGAAGTCTACAGTTTGCCTGGAATGAAGCATGAGAACATA
TTACAGTTCATTGGTGCAGAAAAACGAGGCACCAGTGTTGATGTGGATCTTTGGCTGATCACAGCATTT
CATGAAAAGGGTTCACTATCAGACTTTCTTAAGGCTAATGTGGTCTCTTGGAATGAACTGTGTCATATT
GCAGAAACCATGGCTAGAGGATTGGCATATTTACATGAGGATATACCTGGCCTAAAAGATGGCCACAAA
CCTGCCATATCTCACAGGGACATCAAAAGTAAAAATGTGCTGTTGAAAAACAACCTGACAGCTTGCATT
GCTGACTTTGGGTTGGCCTTAAAATTTGAGGCTGGCAAGTCTGCAGGCGATACCCATGGACAGGTTGGT
ACCCGGAGGTACATGGCTCCAGAGGTATTAGAGGGTGCTATAAACTTCCAAAGGGATGCATTTTTGAGG
ATAGATATGTATGCCATGGGATTAGTCCTATGGGAACTGGCTTCTCGCTGTACTGCTGCAGATGGACCT
GTAGATGAATACATGTTGCCATTTGAGGAGGAAATTGGCCAGCATCCATCTCTTGAAGACATGCAGGAA
GTTGTTGTGCATAAAAAAAAGAGGCCTGTTTTAAGAGATTATTGGCAGAAACATGCTGGAATGGCAATG
CTCTGTGAAACCATTGAAGAATGTTGGGATCACGACGCAGAAGCCAGGTTATCAGCTGGATGTGTAGGT
GAAAGAATTACCCAGATGCAGAGACTAACAAATATTATTACCACAGAGGACATTGTAACAGTGGTCACA
ATGGTGACAAATGTTGACTTTCCTCCCAAAGAATCTAGTCTATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278580
Insert Size 1218 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278580.1
RefSeq Size 5177 bp
RefSeq ORF 1218 bp
Locus ID 92
UniProt ID P27037
Cytogenetics 2q22.3-q23.1
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, TGF-beta signaling pathway
MW 45.7 kDa
Gene Summary This gene encodes a receptor that mediates the functions of activins, which are members of the transforming growth factor-beta (TGF-beta) superfamily involved in diverse biological processes. The encoded protein is a transmembrane serine-threonine kinase receptor which mediates signaling by forming heterodimeric complexes with various combinations of type I and type II receptors and ligands in a cell-specific manner. The encoded type II receptor is primarily involved in ligand-binding and includes an extracellular ligand-binding domain, a transmembrane domain and a cytoplasmic serine-threonine kinase domain. This gene may be associated with susceptibility to preeclampsia, a pregnancy-related disease which can result in maternal and fetal morbidity and mortality. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (3) lacks an alternate exon and uses an alternate splice site in an internal exon, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.