WNT2B (NM_001291880) Human Untagged Clone

CAT#: SC335183

WNT2B (untagged) - Human wingless-type MMTV integration site family, member 2B (WNT2B), transcript variant 3


  "NM_001291880" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-WNT2B Antibody
    • 100 ul

USD 485.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "WNT2B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WNT2B
Synonyms WNT13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335183 representing NM_001291880.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGTTCAGTGGGCGAGGGTGCCCGAGAATGGATCCGAGAGTGTCAGCACCAATTCCGCCACCACCGC
TGGAACTGTACCACCCTGGACCGGGACCACACCGTCTTTGGCCGTGTCATGCTCAGAAGTAGCCGAGAG
GCAGCTTTTGTATATGCCATCTCATCAGCAGGGGTAGTCCACGCTATTACTCGCGCCTGTAGCCAGGGT
GAACTGAGTGTGTGCAGCTGTGACCCCTACACCCGTGGCCGACACCATGACCAGCGTGGGGACTTTGAC
TGGGGTGGCTGCAGTGACAACATCCACTACGGTGTCCGTTTTGCCAAGGCCTTCGTGGATGCCAAGGAG
AAGAGGCTTAAGGATGCCCGGGCCCTCATGAACTTACATAATAACCGCTGTGGTCGCACGGCTGTGCGG
CGGTTTCTGAAGCTGGAGTGTAAGTGCCATGGCGTGAGTGGTTCCTGTACTCTGCGCACCTGCTGGCGT
GCACTCTCAGATTTCCGCCGCACAGGTGATTACCTGCGGCGACGCTATGATGGGGCTGTGCAGGTGATG
GCCACCCAAGATGGTGCCAACTTCACCGCAGCCCGCCAAGGCTATCGCCGTGCCACCCGGACTGATCTT
GTCTACTTTGACAACTCTCCAGATTACTGTGTCTTGGACAAGGCTGCAGGTTCCCTAGGCACTGCAGGC
CGTGTCTGCAGCAAGACATCAAAAGGAACAGACGGTTGTGAAATCATGTGCTGTGGCCGAGGGTACGAC
ACAACTCGAGTCACCCGTGTTACCCAGTGTGAGTGCAAATTCCACTGGTGCTGTGCTGTACGGTGCAAG
GAATGCAGAAATACTGTGGACGTCCATACTTGCAAAGCCCCCAAGAAGGCAGAGTGGCTGGACCAAACC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001291880
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291880.1
RefSeq Size 2854 bp
RefSeq ORF 900 bp
Locus ID 7482
UniProt ID Q93097
Cytogenetics 1p13.2
Protein Families Secreted Protein
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
MW 33.9 kDa
Gene Summary This gene encodes a member of the wingless-type MMTV integration site (WNT) family of highly conserved, secreted signaling factors. WNT family members function in a variety of developmental processes including regulation of cell growth and differentiation and are characterized by a WNT-core domain. This gene may play a role in human development as well as carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (3) differs in the 5' UTR and uses a downstream start codon, compared to variant WNT-2B2. The encoded isoform (3) has a shorter N-terminus, compared to isoform WNT-2B2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.