IL36 gamma (IL36G) (NM_001278568) Human Untagged Clone

CAT#: SC333823

IL36G (untagged) - Human interleukin 36, gamma (IL36G), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL36 gamma
• Synonyms: IL-1F9; IL-1H1; IL-1RP2; IL1E; IL1F9; IL1H1; IL1RP2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC333823 representing NM_001278568.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGAGGCACTCCAGGAGACGCTGATGGTGGAGGAAGGGCCGTCTATCAATCAATCACTGTTGCTGTT
  ATCACATGCAAGTATCCAGAGGCTCTTGAGCAAGGCAGAGGGGATCCCATTTATTTGGGAATCCAGAAT
  CCAGAAATGTGTTTGTATTGTGAGAAGGTTGGAGAACAGCCCACATTGCAGCTAAAAGAGCAGAAGATC
  ATGGATCTGTATGGCCAACCCGAGCCCGTGAAACCCTTCCTTTTCTACCGTGCCAAGACTGGTAGGACC
  TCCACCCTTGAGTCTGTGGCCTTCCCGGACTGGTTCATTGCCTCCTCCAAGAGAGACCAGCCCATCATT
  CTGACTTCAGAACTTGGGAAGTCATACAACACTGCCTTTGAATTAAATATAAATGACTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278568
• Insert Size: 405 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278568.1
• RefSeq Size: 1107 bp
• RefSeq ORF: 405 bp
• Locus ID: 56300
• UniProt ID: Q9NZH8
• Cytogenetics: 2q14.1
• Protein Families: Druggable Genome, Secreted Protein
• MW: 14.9 kDa
• Gene Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. The activity of this cytokine is mediated by interleukin 1 receptor-like 2 (IL1RL2/IL1R-rp2), and is specifically inhibited by interleukin 1 family, member 5 (IL1F5/IL-1 delta). Interferon-gamma, tumor necrosis factor-alpha and interleukin 1, beta (IL1B) are reported to stimulate the expression of this cytokine in keratinocytes. The expression of this cytokine in keratinocytes can also be induced by a contact hypersensitivity reaction or herpes simplex virus infection. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, May 2019]
  Transcript Variant: This variant (2) lacks an in-frame exon in the 5' region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1.