SNX17 (NM_001267061) Human Untagged Clone

CAT#: SC332843

SNX17 (untagged) - Homo sapiens sorting nexin 17 (SNX17), transcript variant 4


  "NM_001267061" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


SNX17 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "SNX17"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SNX17
Vector pCMV6-Entry
Sequence Data
>SC332843 representing NM_001267061.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCTATAACATTCACGTGAATGGAGTCCTGCACTGTCGGGTGCGCTACAGCCAGCTCCTGGGGCTG
CACGAGCAGCTTCGGAAGGAGTATGGGGCCAATGTGCTTCCTGCATTCCCCCCAAAGAAGCTTTTCTCT
CTGACTCCTGCTGAGGTAGAACAGAGGAGAGAGCAGTTAGAGAAGTACATGCAAGCTGTTCGGCAAGAC
CCATTGCTTGGGAGCAGCGAGACTTTCAACAGTTTCCTGCGTCGGGCACAACAGGAGACACAGCAGGTC
CCCACAGAGGAAGTGTCCTTGGAAGTGCTGCTCAGCAACGGGCAGAAAGTTCTGGTCAACGTGCTAACT
TCAGATCAGACTGAGGATGTCCTGGAGGCTGTAGCTGCAAAGCTGGATCTTCCAGATGACTTGATTGGA
TACTTTAGTCTATTCTTAGTTCGAGAAAAAGAGGATGGAGCCTTTTCTTTTGTACGGAAGTTGCAAGAG
TTTGAGCTGCCTTATGTGTCTGTCACCAGCCTTCGGAGTCAAGAGTATAAGATTGTGCTAAGGAAGAGT
TATTGGGACTCTGCCTATGATGACGATGTCATGGAGAACCGGGTTGGCCTGAACCTGCTTTATGCTCAG
ACGGTATCAGATATTGAGCGTGGGTGGATCTTGGTCACCAAGGAACAGCACCGGCAACTCAAATCTCTG
CAAGAGAAAGTCTCCAAGAAGGAGTTCCTGAGACTGGCCCAGACGCTGCGGCACTATGGCTACTTGCGC
TTTGATGCCTGTGTGGCTGACTTCCCAGAAAAGGACTGTCCTGTGGTGGTGAGCGCGGGCAACAGTGAG
CTCAGCCTGCAGCTCCGCCTGCCTGGCCAGCAACTCCGAGAAGGCTCCTTCCGGGTCACCCGCATGCGA
TGCTGGCGGGTCACCTCCTCTGTACCATTGCCCAGTGGAAGCACGAGCAGCCCAGGCCGGGGCCGGGGT
GAGGTGCGCCTGGAACTGGCTTTTGAATACCTCATGAGCAAGGACCGGCTACAGTGGGTCACCATCACT
AGCCCCCAGGCTATCATGATGAGCATCTGCTTGCAGTCCATGGTTGATGAACTGATGGTGAAGAAATCT
GGCGGCAGTATCAGGAAGATGCTGCGCCGGCGGGTGGGGGGTACTCTGAGACGCTCAGACAGCCAGCAA
GCAGTGAAGTCCCCACCACTGCTTGAGTCACCTGATGCCACCCGGGAGTCTATGGTCAAACTCTCAAGT
AAGCTGAGTGCCGTGAGCTTGCGGGGAATTGGCAGTCCCAGCACAGATGCCAGTGCCAGTGATGTCCAC
GGCAATTTCGCCTTCGAGGGCATTGGAGATGAGGATCTGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001267061
Insert Size 1353 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001267061.1
RefSeq Size 2310 bp
RefSeq ORF 1353 bp
Locus ID 9784
Cytogenetics 2p23.3
Protein Families Druggable Genome
MW 50.8 kDa
Gene Summary This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members, but contains a B41 domain. This protein interacts with the cytoplasmic domain of P-selectin, and may function in the intracellular trafficking of P-selectin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2012]
Transcript Variant: This variant (4) contains an alternate 5' exon contains an alternate exon, lacks a portion of the 5' coding region, and initiates translation at an alternate upstream start codon, compared to variant 1. The encoded protein (isoform 4) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.