SNX17 (NM_001267060) Human Untagged Clone

SKU
SC332842
SNX17 (untagged) - Homo sapiens sorting nexin 17 (SNX17), transcript variant 3
$503.00
5 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SNX17
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC332842 representing NM_001267060.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCACTTTTCCATTCCCGAAACCGAGTCCCGCAGCGGGGACAGCGGCGGCTCCGCCTACGTGCTTCGG
AAGGAGTATGGGGCCAATGTGCTTCCTGCATTCCCCCCAAAGAAGCTTTTCTCTCTGACTCCTGCTGAG
GTAGAACAGAGGAGAGAGCAGTTAGAGAAGTACATGCAAGCTGTTCGGCAAGACCCATTGCTTGGGAGC
AGCGAGACTTTCAACAGTTTCCTGCGTCGGGCACAACAGGAGACACAGCAGGTCCCCACAGAGGAAGTG
TCCTTGGAAGTGCTGCTCAGCAACGGGCAGAAAGTTCTGGTCAACGTGCTAACTTCAGATCAGACTGAG
GATGTCCTGGAGGCTGTAGCTGCAAAGCTGGATCTTCCAGATGACTTGATTGGATACTTTAGTCTATTC
TTAGTTCGAGAAAAAGAGGATGGAGCCTTTTCTTTTGTACGGAAGTTGCAAGAGTTTGAGCTGCCTTAT
GTGTCTGTCACCAGCCTTCGGAGTCAAGAGTATAAGATTGTGCTAAGGAAGAGTTATTGGGACTCTGCC
TATGATGACGATGTCATGGAGAACCGGGTTGGCCTGAACCTGCTTTATGCTCAGACGGTATCAGATATT
GAGCGTGGGTGGATCTTGGTCACCAAGGAACAGCACCGGCAACTCAAATCTCTGCAAGAGAAAGTCTCC
AAGAAGGAGTTCCTGAGACTGGCCCAGACGCTGCGGCACTATGGCTACTTGCGCTTTGATGCCTGTGTG
GCTGACTTCCCAGAAAAGGACTGTCCTGTGGTGGTGAGCGCGGGCAACAGTGAGCTCAGCCTGCAGCTC
CGCCTGCCTGGCCAGCAACTCCGAGAAGGCTCCTTCCGGGTCACCCGCATGCGATGCTGGCGGGTCACC
TCCTCTGTACCATTGCCCAGTGGAAGCACGAGCAGCCCAGGCCGGGGCCGGGGTGAGGTGCGCCTGGAA
CTGGCTTTTGAATACCTCATGAGCAAGGACCGGCTACAGTGGGTCACCATCACTAGCCCCCAGGCTATC
ATGATGAGCATCTGCTTGCAGTCCATGGTTGATGAACTGATGGTGAAGAAATCTGGCGGCAGTATCAGG
AAGATGCTGCGCCGGCGGGTGGGGGGTACTCTGAGACGCTCAGACAGCCAGCAAGCAGTGAAGTCCCCA
CCACTGCTTGAGTCACCTGATGCCACCCGGGAGTCTATGGTCAAACTCTCAAGTAAGCTGAGTGCCGTG
AGCTTGCGGGGAATTGGCAGTCCCAGCACAGATGCCAGTGCCAGTGATGTCCACGGCAATTTCGCCTTC
GAGGGCATTGGAGATGAGGATCTGTAA

Restriction Sites SgfI-MluI
ACCN NM_001267060
Insert Size 1338 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001267060.1
RefSeq Size 2400 bp
RefSeq ORF 1338 bp
Locus ID 9784
UniProt ID Q15036
Cytogenetics 2p23.3
Protein Families Druggable Genome
MW 50 kDa
Summary This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members, but contains a B41 domain. This protein interacts with the cytoplasmic domain of P-selectin, and may function in the intracellular trafficking of P-selectin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2012]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. The resulting protein (isoform 3) is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:SNX17 (NM_001267060) Human Untagged Clone
Your Rating
SKU Description Size Price
RC234123 SNX17 (Myc-DDK tagged) - Homo sapiens sorting nexin 17 (SNX17), transcript variant 3 10 ug
$503.00
RG234123 SNX17 (tGFP-tagged) - Homo sapiens sorting nexin 17 (SNX17), transcript variant 3 10 ug
$703.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.