DDX56 (NM_001257189) Human Untagged Clone

SKU
SC330573
DDX56 (untagged) - Homo sapiens DEAD (Asp-Glu-Ala-Asp) box helicase 56 (DDX56), transcript variant 2
$520.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DDX56
Synonyms DDX21; DDX26; NOH61
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC330573 representing NM_001257189.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGGACTCTGAAGCACTGGGCTTCGAACACATGGGCCTCGATCCCCGGCTCCTTCAGGCTGTCACC
GATCTGGGCTGGTCGCGACCTACGCTGATCCAGGAGAAGGCCATCCCACTGGCCCTAGAAGGGAAGGAC
CTCCTGGCTCGGGCCCGCACGGGCTCCGGGAAGACGGCCGCTTATGCTATTCCGATGCTGCAGCTGTTG
CTCCATAGGAAGGCGACAGGTCCGGTGGTAGAACAGGCAGTGAGAGGCCTTGTTCTTGTTCCTACCAAG
GAGCTGGCACGGCAAGCACAGTCCATGATTCAGCAGCTGGCTACCTACTGTGCTCGGGATGTCCGAGTG
GCCAATGTCTCAGCTGCTGAAGACTCAGTCTCTCAGAGAGCTGTGCTGATGGAGAAGCCAGATGTGGTA
GTAGGGACCCCATCTCGCATATTAAGCCACTTGCAGCAAGACAGCCTGAAACTTCGTGACTCCCTGGAG
CTTTTGGTGGTGGACGAAGCTGACCTTCTTTTTTCCTTTGGCTTTGAAGAAGAGCTCAAGAGTCTCCTC
TGTCACTTGCCCCGGATTTACCAGGCTTTTCTCATGTCAGCTACTTTTAACGAGGACGTACAAGCACTC
AAGGAGCTGATATTACATAACCCGGTTACCCTTAAGTTACAGGAGTCCCAGCTGCCTGGGCCAGACCAG
TTACAGCAGTTTCAGGTGGTCTGTGAGACTGAGGAAGACAAATTCCTCCTGCTGTATGCCCTGCTCAAG
CTGTCATTGATTCGGGGCAAGTCTCTGCTCTTTGTCAACACTCTAGAACGGAGTTACCGGCTACGCCTG
TTCTTGGAACAGTTCAGCATCCCCACCTGTGTGCTCAATGGAGAGCTTCCACTGCGCTCCAGGGCCTCT
GATCCGGAAGCAGGTGTGGCCCGGGGCATAGACTTCCACCATGTGTCTGCTGTGCTCAACTTTGATCTT
CCCCCAACCCCTGAGGCCTACATCCATCGAGCTGGCAGGACAGCACGCGCTAACAACCCAGGCATAGTC
TTAACCTTTGTGCTTCCCACGGAGCAGTTCCACTTAGGCAAGATTGAGGAGCTTCTCAGTGGAGAGAAC
AGGGGCCCCATTCTGCTCCCCTACCAGTTCCGGATGGAGGAGATCGAGGGCTTCCGCTATCGCTGCAGG
GATGCCATGCGCTCAGTGACTAAGCAGGCCATTCGGGAGGCAAGATTGAAGGAGATCAAGGAAGAGCTT
CTGCATTCTGAGAAGCTTAAGACATACTTTGAAGACAACCCTAGGGACCTCCAGCTGCTGCGGCATGAC
CTACCTTTGCACCCCGCAGTGGTGAAGCCCCACCTGGGCCATGTTCCTGACTACCTGGTTCCTCCTGCT
CTCCGTGGCCTGGTGCGCCCTCACAAGAAGCGGAAGAAGCTGTCTTCCTCTTGTAGGAAGGCCAAGAGA
GCAAAGTCCCAGAACCCACTGCGCAGCTTCAAGCACAAAGGAAAGAAATTCAGACCCACAGCCAAGCCC
TCCTGA

Restriction Sites SgfI-MluI
ACCN NM_001257189
Insert Size 1524 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001257189.1
RefSeq Size 2769 bp
RefSeq ORF 1524 bp
Locus ID 54606
UniProt ID Q9NY93
Cytogenetics 7p13
MW 57.3 kDa
Summary This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene shows ATPase activity in the presence of polynucleotides and associates with nucleoplasmic 65S preribosomal particles. This gene may be involved in ribosome synthesis, most likely during assembly of the large 60S ribosomal subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting protein (isoform 2) is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:DDX56 (NM_001257189) Human Untagged Clone
Your Rating
SKU Description Size Price
RC232889 DDX56 (Myc-DDK tagged) - Homo sapiens DEAD (Asp-Glu-Ala-Asp) box helicase 56 (DDX56), transcript variant 2 10 ug
$519.00
RG232889 DDX56 (tGFP-tagged) - Homo sapiens DEAD (Asp-Glu-Ala-Asp) box helicase 56 (DDX56), transcript variant 2 10 ug
$719.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.