GBA (NM_001171811) Human Untagged Clone

CAT#: SC328742

GBA (untagged)-Human glucosidase beta acid (GBA) transcript variant 4


  "NM_001171811" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
GBA mouse monoclonal antibody, clone OTI4G4 (formerly 4G4)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GBA
Synonyms GBA1; GCB; GLUC
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001171811, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGAGTATGGGGCCCATCCAGGCTAATCACACGGGCACAGGCCTGCTACTGACC
CTGCAGCCAGAACAGAAGTTCCAGAAAGTGAAGGGATTTGGAGGGGCCATGACAGATGCT
GCTGCTCTCAACATCCTTGCCCTGTCACCCCCTGCCCAAAATTTGCTACTTAAATCGTAC
TTCTCTGAAGAAGGAATCGGATATAACATCATCCGGGTACCCATGGCCAGCTGTGACTTC
TCCATCCGCACCTACACCTATGCAGACACCCCTGATGATTTCCAGTTGCACAACTTCAGC
CTCCCAGAGGAAGATACCAAGCTCAAGATACCCCTGATTCACCGAGCCCTGCAGTTGGCC
CAGCGTCCCGTTTCACTCCTTGCCAGCCCCTGGACATCACCCACTTGGCTCAAGACCAAT
GGAGCGGTGAATGGGAAGGGGTCACTCAAGGGACAGCCCGGAGACATCTACCACCAGACC
TGGGCCAGATACTTTGTGAAGTTCCTGGATGCCTATGCTGAGCACAAGTTACAGTTCTGG
GCAGTGACAGCTGAAAATGAGCCTTCTGCTGGGCTGTTGAGTGGATACCCCTTCCAGTGC
CTGGGCTTCACCCCTGAACATCAGCGAGACTTCATTGCCCGTGACCTAGGTCCTACCCTC
GCCAACAGTACTCACCACAATGTCCGCCTACTCATGCTGGATGACCAACGCTTGCTGCTG
CCCCACTGGGCAAAGGTGGTACTGACAGACCCAGAAGCAGCTAAATATGTTCATGGCATT
GCTGTACATTGGTACCTGGACTTTCTGGCTCCAGCCAAAGCCACCCTAGGGGAGACACAC
CGCCTGTTCCCCAACACCATGCTCTTTGCCTCAGAGGCCTGTGTGGGCTCCAAGTTCTGG
GAGCAGAGTGTGCGGCTAGGCTCCTGGGATCGAGGGATGCAGTACAGCCACAGCATCATC
ACGAACCTCCTGTACCATGTGGTCGGCTGGACCGACTGGAACCTTGCCCTGAACCCCGAA
GGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCCCATCATTGTAGACATCACCAAG
GACACGTTTTACAAACAGCCCATGTTCTACCACCTTGGCCACTTCAGCAAGTTCATTCCT
GAGGGCTCCCAGAGAGTGGGGCTGGTTGCCAGTCAGAAGAACGACCTGGACGCAGTGGCA
CTGATGCATCCCGATGGCTCTGCTGTTGTGGTCGTGCTAAACCGCTCCTCTAAGGATGTG
CCTCTTACCATCAAGGATCCTGCTGTGGGCTTCCTGGAGACAATCTCACCTGGCTACTCC
ATTCACACCTACCTGTGGCGTCGCCAGTGA
Restriction Sites Please inquire     
ACCN NM_001171811
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001171811.1, NP_001165282.1
RefSeq Size 2400 bp
RefSeq ORF 1350 bp
Locus ID 2629
UniProt ID P04062
Cytogenetics 1q22
Protein Families Druggable Genome
Protein Pathways Lysosome, Metabolic pathways, Other glycan degradation, Sphingolipid metabolism
Gene Summary This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.