ornithine aminotransferase (OAT) (NM_001171814) Human Untagged Clone

SKU
SC328490
OAT (untagged)-Human ornithine aminotransferase (OAT) transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ornithine aminotransferase
Synonyms GACR; HOGA; OATASE; OKT
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001171814, the custom clone sequence may differ by one or more nucleotides
ATGAATACAGGAGTGGAGGCTGGAGAGACTGCCTGTAAACTAGCTCGTAAGTGGGGCTAT
ACCGTGAAGGGCATTCAGAAATACAAAGCAAAGATTGTTTTTGCAGCTGGGAACTTCTGG
GGTAGGACGTTGTCTGCTATCTCCAGTTCCACAGACCCAACCAGTTACGATGGTTTTGGA
CCATTTATGCCGGGATTCGACATCATTCCCTATAATGATCTGCCCGCACTGGAGCGTGCT
CTTCAGGATCCAAATGTGGCTGCGTTCATGGTAGAACCAATTCAGGGTGAAGCAGGCGTT
GTTGTTCCGGATCCAGGTTACCTAATGGGAGTGCGAGAGCTCTGCACCAGGCACCAGGTT
CTCTTTATTGCTGATGAAATACAGACAGGATTGGCCAGAACTGGTAGATGGCTGGCTGTT
GATTATGAAAATGTCAGACCTGATATAGTCCTCCTTGGAAAGGCCCTTTCTGGGGGCTTA
TACCCTGTGTCTGCAGTGCTGTGTGATGATGACATCATGCTGACCATTAAGCCAGGGGAG
CATGGGTCCACATACGGTGGCAATCCACTAGGCTGCCGAGTGGCCATCGCAGCCCTTGAG
GTTTTAGAAGAAGAAAACCTTGCTGAAAATGCAGACAAATTGGGCATTATCTTGAGAAAT
GAACTCATGAAGCTACCTTCTGATGTTGTAACTGCCGTAAGAGGAAAAGGATTATTAAAC
GCTATTGTCATTAAAGAAACCAAAGATTGGGATGCTTGGAAGGTGTGTCTACGACTTCGA
GATAATGGACTTCTGGCCAAGCCAACCCATGGCGACATTATCAGGTTTGCGCCTCCGCTG
GTGATCAAGGAGGATGAGCTTCGAGAGTCCATTGAAATTATTAACAAGACCATCTTGTCT
TTCTGA
Restriction Sites Please inquire
ACCN NM_001171814
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001171814.1, NP_001165285.1
RefSeq Size 1874 bp
RefSeq ORF 906 bp
Locus ID 4942
UniProt ID P04181
Cytogenetics 10q26.13
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Metabolic pathways
Summary This gene encodes the mitochondrial enzyme ornithine aminotransferase, which is a key enzyme in the pathway that converts arginine and ornithine into the major excitatory and inhibitory neurotransmitters glutamate and GABA. Mutations that result in a deficiency of this enzyme cause the autosomal recessive eye disease Gyrate Atrophy. Alternatively spliced transcript variants encoding different isoforms have been described. Related pseudogenes have been defined on the X chromosome. [provided by RefSeq, Jan 2010]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
Write Your Own Review
You're reviewing:ornithine aminotransferase (OAT) (NM_001171814) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229852 OAT (Myc-DDK-tagged)-Human ornithine aminotransferase (OAT), transcript variant 2 10 ug
$503.00
RC229852L3 Lenti-ORF clone of OAT (Myc-DDK-tagged)-Human ornithine aminotransferase (OAT), transcript variant 2 10 ug
$803.00
RC229852L4 Lenti-ORF clone of OAT (mGFP-tagged)-Human ornithine aminotransferase (OAT), transcript variant 2 10 ug
$803.00
RG229852 OAT (tGFP-tagged) - Human ornithine aminotransferase (OAT), transcript variant 2 10 ug
$703.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.