SLC29A3 (NM_001174098) Human Untagged Clone
SKU
SC328418
SLC29A3 (untagged)-Human solute carrier family 29 (nucleoside transporters) member 3 (SLC29A3) transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | SLC29A3 |
Synonyms | ENT3; HCLAP; HJCD; PHID |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001174098, the custom clone sequence may differ by one or more nucleotides
ATGGCCGTTGTCTCAGAGGACGACTTTCAGCACAGTTCAAACTCCACCTACAGAACCACA AGCAGCAGTCTCCGAGCTGACCAGGAGGCACTGCTTGAGAAGCTGCTGGACCGCCCGCCC CCTGGCCTGCAGAGGCCCGAGGACCGCTTCTGTGGCACATACATCATCTTCTTCAGCCTG GGCATTGGCAGTCTACTGCCATGGAACTTCTTTATCACTGCCAAGGAGTACTGGATGTTC AAACTCCGCAACTCCTCCAGCCCAGCCACCGGGGAGGACCCTGAGGGCTCAGACATCCTG AACTACTTTGAGAGCTACCTTGCCGTTGCCTCCACCGTGCCCTCCATGCTGTGCCTGGTG GCCAACTTCCTGCTTGTCAACAGGGTTGCAGTCCACATCCGTGTCCTGGCCTCACTGACG GTCATCCTGGCCATCTTCATGGTGATAACTGCACTGGTGAAGGTGGACACTTCCTCCTGG ACCCGTGGCTTTTTTGCGGTCACCATTGTCTGCATGGTGATCCTCAGCGGTGCCTCCACT GTCTTCAGCAGCAGCATCTACGGCATGACCGGCTCCTTTCCTATGAGGAACTCCCAGGCA CTGATATCAGGAGGAGCCATGGGCGGGACGGTCAGCGCCGTGGCCTCATTGGTGGACTTG GCTGCATCCAGTGATGTGAGGAACAGCGCCCTGGCCTTCTTCCTGACGGCCACTGTCTTC CTCGTGCTCTGCATGGGACTCTACCTGCTGCTGTCCAGGCTGGAGTATGCCAGGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001174098 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001174098.1, NP_001167569.1 |
RefSeq Size | 2283 bp |
RefSeq ORF | 777 bp |
Locus ID | 55315 |
UniProt ID | Q9BZD2 |
Cytogenetics | 10q22.1 |
Protein Families | Transmembrane |
Summary | This gene encodes a nucleoside transporter. The encoded protein plays a role in cellular uptake of nucleosides, nucleobases, and their related analogs. Mutations in this gene have been associated with H syndrome, which is characterized by cutaneous hyperpigmentation and hypertrichosis, hepatosplenomegaly, heart anomalies, and hypogonadism. A related disorder, PHID (pigmented hypertrichosis with insulin-dependent diabetes mellitus), has also been associated with mutations at this locus. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2010] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform b, which is shorter than isoform a. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC229780 | SLC29A3 (Myc-DDK-tagged)-Human solute carrier family 29 (nucleoside transporters), member 3 (SLC29A3), transcript variant 2 | 10 ug |
$556.00
|
|
RC229780L3 | Lenti-ORF clone of SLC29A3 (Myc-DDK-tagged)-Human solute carrier family 29 (nucleoside transporters), member 3 (SLC29A3), transcript variant 2 | 10 ug |
$856.00
|
|
RC229780L4 | Lenti-ORF clone of SLC29A3 (mGFP-tagged)-Human solute carrier family 29 (nucleoside transporters), member 3 (SLC29A3), transcript variant 2 | 10 ug |
$856.00
|
|
RG229780 | SLC29A3 (tGFP-tagged) - Human solute carrier family 29 (nucleoside transporters), member 3 (SLC29A3), transcript variant 2 | 10 ug |
$756.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.