MYD88 (NM_001172569) Human Untagged Clone
SKU
SC328320
MYD88 (untagged)-Human myeloid differentiation primary response gene (88) (MYD88) transcript variant 4
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | MYD88 |
Synonyms | IMD68; MYD88D |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001172569, the custom clone sequence may differ by one or more nucleotides
ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGC GCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATG CGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGG ACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAA GCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGC CGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCC AGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCTGAGAAG CCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATC ACCACACTTGATGACCCCCTGGGTGCCGCCGGATGGTGGTGGTTGTCTCTGATGATTACC TGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTCTCTCCAGGTGCCC ATCAGAAGCGACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001172569 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001172569.1, NP_001166040.1 |
RefSeq Size | 2681 bp |
RefSeq ORF | 615 bp |
Locus ID | 4615 |
UniProt ID | Q99836 |
Cytogenetics | 3p22.2 |
Protein Families | Druggable Genome |
Protein Pathways | Apoptosis, Toll-like receptor signaling pathway |
Summary | This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010] Transcript Variant: This variant (4) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC229682 | MYD88 (Myc-DDK-tagged)-Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 4 | 10 ug |
$330.00
|
|
RC229682L3 | Lenti-ORF clone of MYD88 (Myc-DDK-tagged)-Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 4 | 10 ug |
$630.00
|
|
RC229682L4 | Lenti-ORF clone of MYD88 (mGFP-tagged)-Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 4 | 10 ug |
$630.00
|
|
RG229682 | MYD88 (tGFP-tagged) - Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 4 | 10 ug |
$530.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.