MYD88 (NM_001172569) Human Untagged Clone

SKU
SC328320
MYD88 (untagged)-Human myeloid differentiation primary response gene (88) (MYD88) transcript variant 4
$330.00
4 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MYD88
Synonyms IMD68; MYD88D
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001172569, the custom clone sequence may differ by one or more nucleotides
ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGC
GCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATG
CGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGG
ACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAA
GCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGC
CGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCC
AGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCTGAGAAG
CCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATC
ACCACACTTGATGACCCCCTGGGTGCCGCCGGATGGTGGTGGTTGTCTCTGATGATTACC
TGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTCTCTCCAGGTGCCC
ATCAGAAGCGACTGA
Restriction Sites Please inquire
ACCN NM_001172569
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001172569.1, NP_001166040.1
RefSeq Size 2681 bp
RefSeq ORF 615 bp
Locus ID 4615
UniProt ID Q99836
Cytogenetics 3p22.2
Protein Families Druggable Genome
Protein Pathways Apoptosis, Toll-like receptor signaling pathway
Summary This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (4) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:MYD88 (NM_001172569) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229682 MYD88 (Myc-DDK-tagged)-Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 4 10 ug
$330.00
RC229682L3 Lenti-ORF clone of MYD88 (Myc-DDK-tagged)-Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 4 10 ug
$630.00
RC229682L4 Lenti-ORF clone of MYD88 (mGFP-tagged)-Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 4 10 ug
$630.00
RG229682 MYD88 (tGFP-tagged) - Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 4 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.