C9orf25 (FAM219A) (NM_001184942) Human Untagged Clone
SKU
SC328273
FAM219A (untagged)-Human chromosome 9 open reading frame 25 (C9orf25) transcript variant 3
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | C9orf25 |
Synonyms | C9orf25 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001184942, the custom clone sequence may differ by one or more nucleotides
ATGATGGAGGAGATCGACCGGTTCCAGGACCCAGCCGCCGCCTCCATCTCTGACGGAGAC TGTGACGCCCGGGAGGGTGAGTCAGTAGCCATGAATTACAAACCATCCCCGCTCCAAGTG AAGCTGGAGAAGCAGCGGGAGCTGGCCCGGAAGGGCTCCCTGAAGAATGGCAGCATGGGT AGCCCTGTCAACCAGCAACCCAAGAAGAACAATGTCATGGCCCGAACAAGGCTGGTCGTC CCCAATAAAGGCTACTCCTCACTTGACCAGAGCCCTGATGAGAAGCCACTGGTAGCCCTT GACACGGACAGCGATGATGACTTTGACATGTCTAGATACTCCTCCTCCGGCTACTCCTCT GCTGAGATCAACCAAGATTTGAACATCCAGCTGCTGAAGGACGGCTACCGGTTAGATGAG ATCCCCGACGACGAGGACCTAGACCTCATCCCCCCCAAGTCCGTGAACCCCACGTGCATG TGCTGCCAGGCCACGTCCTCCACCGCCTGCCACATTCAGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001184942 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001184942.1, NP_001171871.1 |
RefSeq Size | 3656 bp |
RefSeq ORF | 522 bp |
Locus ID | 203259 |
UniProt ID | Q8IW50 |
Cytogenetics | 9p13.3 |
Summary | The protein encoded by this gene has homologs that have been identified in mouse, macaque, etc organisms. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (3) uses two different splice sites in the coding region, compared to variant 1. The resulting protein (isoform 3) is shorter when it is compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC229635 | FAM219A (Myc-DDK-tagged)-Human chromosome 9 open reading frame 25 (C9orf25), transcript variant 3 | 10 ug |
$330.00
|
|
RC229635L3 | Lenti-ORF clone of FAM219A (Myc-DDK-tagged)-Human chromosome 9 open reading frame 25 (C9orf25), transcript variant 3 | 10 ug |
$630.00
|
|
RC229635L4 | Lenti-ORF clone of FAM219A (mGFP-tagged)-Human chromosome 9 open reading frame 25 (C9orf25), transcript variant 3 | 10 ug |
$630.00
|
|
RG229635 | FAM219A (tGFP-tagged) - Human chromosome 9 open reading frame 25 (C9orf25), transcript variant 3 | 10 ug |
$530.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.