C9orf25 (FAM219A) (NM_001184942) Human Untagged Clone

SKU
SC328273
FAM219A (untagged)-Human chromosome 9 open reading frame 25 (C9orf25) transcript variant 3
$330.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C9orf25
Synonyms C9orf25
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001184942, the custom clone sequence may differ by one or more nucleotides
ATGATGGAGGAGATCGACCGGTTCCAGGACCCAGCCGCCGCCTCCATCTCTGACGGAGAC
TGTGACGCCCGGGAGGGTGAGTCAGTAGCCATGAATTACAAACCATCCCCGCTCCAAGTG
AAGCTGGAGAAGCAGCGGGAGCTGGCCCGGAAGGGCTCCCTGAAGAATGGCAGCATGGGT
AGCCCTGTCAACCAGCAACCCAAGAAGAACAATGTCATGGCCCGAACAAGGCTGGTCGTC
CCCAATAAAGGCTACTCCTCACTTGACCAGAGCCCTGATGAGAAGCCACTGGTAGCCCTT
GACACGGACAGCGATGATGACTTTGACATGTCTAGATACTCCTCCTCCGGCTACTCCTCT
GCTGAGATCAACCAAGATTTGAACATCCAGCTGCTGAAGGACGGCTACCGGTTAGATGAG
ATCCCCGACGACGAGGACCTAGACCTCATCCCCCCCAAGTCCGTGAACCCCACGTGCATG
TGCTGCCAGGCCACGTCCTCCACCGCCTGCCACATTCAGTAG
Restriction Sites Please inquire
ACCN NM_001184942
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001184942.1, NP_001171871.1
RefSeq Size 3656 bp
RefSeq ORF 522 bp
Locus ID 203259
UniProt ID Q8IW50
Cytogenetics 9p13.3
Summary The protein encoded by this gene has homologs that have been identified in mouse, macaque, etc organisms. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) uses two different splice sites in the coding region, compared to variant 1. The resulting protein (isoform 3) is shorter when it is compared to isoform 1.
Write Your Own Review
You're reviewing:C9orf25 (FAM219A) (NM_001184942) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229635 FAM219A (Myc-DDK-tagged)-Human chromosome 9 open reading frame 25 (C9orf25), transcript variant 3 10 ug
$330.00
RC229635L3 Lenti-ORF clone of FAM219A (Myc-DDK-tagged)-Human chromosome 9 open reading frame 25 (C9orf25), transcript variant 3 10 ug
$630.00
RC229635L4 Lenti-ORF clone of FAM219A (mGFP-tagged)-Human chromosome 9 open reading frame 25 (C9orf25), transcript variant 3 10 ug
$630.00
RG229635 FAM219A (tGFP-tagged) - Human chromosome 9 open reading frame 25 (C9orf25), transcript variant 3 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.