IVD (NM_002225) Human Untagged Clone

CAT#: SC327852

IVD (untagged)-Human isovaleryl Coenzyme A dehydrogenase (IVD) nuclear gene encoding mitochondrial protein transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IVD
• Synonyms: ACAD2; IVDH
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC327852 representing NM_002225.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCAGAGATGGCGACTGCGACTCGGCTGCTGGGGTGGCGTGTGGCGAGCTGGAGGCTGCGGCCGCCG
  CTTGCCGGCTTCGTTTCCCAGCGGGCCCACTCGCTTTTGCCCGTGGACGATGCAATCAATGGGCTAAGC
  GAGGAGCAGAGGCAGCTTCGTCAGACCATGGCTAAGTTCCTTCAGGAGCACCTGGCCCCCAAGGCCCAG
  GAGATCGATCGCAGCAATGAGTTCAAGAACCTGCGAGAATTTTGGAAGCAGCTGGGGAACCTGGGCGTA
  TTGGGCATCACAGCCCCTGTTCAGTATGGCGGCTCCGGCCTGGGCTACCTGGAGCATGTGCTGGTGATG
  GAGGAGATATCCCGAGCTTCCGGAGCAGTGGGGCTCAGTTACGGTGCCCACTCCAACCTCTGCATCAAC
  CAGCTTGTACGCAATGGGAATGAGGCCCAGAAAGAGAAGTATCTCCCGAAGCTGATCAGTGGTGAGTAC
  ATCGGAGCCCTGGCCATGAGTGAGCCCAATGCAGGCTCTGATGTTGTCTCTATGAAGCTCAAAGCGGAA
  AAGAAAGGAAATCACTACATCCTGAATGGCAACAAGTTCTGGATCACTAATGGCCCTGATGCTGACGTC
  CTGATTGTCTATGCCAAGACAGATCTGGCTGCTGTGCCAGCTTCTCGGGGCATCACAGCCTTCATTGTG
  GAGAAGGGTATGCCTGGCTTTAGCACCTCTAAGAAGCTGGACAAGCTGGGGATGAGGGGCTCTAACACC
  TGTGAGCTAATCTTTGAAGACTGCAAGATTCCTGCTGCCAACATCCTGGGCCATGAGAATAAGGGTGTC
  TACGTGCTGATGAGTGGGCTGGACCTGGAGCGGCTGGTGCTGGCCGGGGGGCCTCTTGGGCTCATGCAA
  GCGGTCCTGGACCACACCATTCCCTACCTGCACGTGAGGGAAGCCTTTGGCCAGAAGATCGGCCACTTC
  CAGTTGATGCAGGGGAAGATGGCTGACATGTACACCCGCCTCATGGCGTGTCGGCAGTATGTCTACAAT
  GTCGCCAAGGCCTGCGATGAGGGCCATTGCACTGCTAAGGACTGTGCAGGTGTGATTCTTTACTCAGCT
  GAGTGTGCCACACAGGTAGCCCTGGACGGCATTCAGTGTTTTGGTGGCAATGGCTACATCAATGACTTT
  CCCATGGGCCGCTTTCTTCGAGATGCCAAGCTGTATGAGATAGGGGCTGGGACCAGCGAGGTGAGGCGG
  CTGGTCATCGGCAGAGCCTTCAATGCAGACTTTCACTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002225
• Insert Size: 1281 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002225.3
• RefSeq Size: 4673 bp
• RefSeq ORF: 1281 bp
• Locus ID: 3712
• UniProt ID: P26440
• Cytogenetics: 15q15.1
• Domains: Acyl-CoA_dh, Acyl-CoA_dh_M, Acyl-CoA_dh_N
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Valine, leucine and isoleucine degradation
• MW: 46.7 kDa
• Gene Summary: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2017]
  Transcript Variant: This variant (1) represents the predominant transcript, and encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.