Claudin 5 (CLDN5) (NM_003277) Human Untagged Clone

SKU
SC327783
CLDN5 (untagged)-Human claudin 5 (CLDN5) transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Claudin 5
Synonyms AWAL; BEC1; CPETRL1; TMDVCF; TMVCF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327783 representing NM_003277.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCCGCGCACGGATTGGCTGCTTCGGGCCGGGGGGCCGGGCCCGGGGGACAGAATCCGCCCCCGAA
CCTTCAAAGAGGGTACCCCCCGGCAGGAGCTGGCAGACCCAGGAGGTGCGACAGACCCGCGGGGCAAAC
GGACTGGGGCCAAGAGCCGGGAGCGCGGGCGCAAAGGCACCAGGGCCCGCCCAGGGCGCCGCGCAGCAC
GGCCTTGGGGGTTCTGCGGGCCTTCGGGTGCGCGTCTCGCCTCTAGCCATGGGGTCCGCAGCGTTGGAG
ATCCTGGGCCTGGTGCTGTGCCTGGTGGGCTGGGGGGGTCTGATCCTGGCGTGCGGGCTGCCCATGTGG
CAGGTGACCGCCTTCCTGGACCACAACATCGTGACGGCGCAGACCACCTGGAAGGGGCTGTGGATGTCG
TGCGTGGTGCAGAGCACCGGGCACATGCAGTGCAAAGTGTACGACTCGGTGCTGGCTCTGAGCACCGAG
GTGCAGGCGGCGCGGGCGCTCACCGTGAGCGCCGTGCTGCTGGCGTTCGTTGCGCTCTTCGTGACCCTG
GCGGGCGCGCAGTGCACCACCTGCGTGGCCCCGGGCCCGGCCAAGGCGCGTGTGGCCCTCACGGGAGGC
GTGCTCTACCTGTTTTGCGGGCTGCTGGCGCTCGTGCCACTCTGCTGGTTCGCCAACATTGTCGTCCGC
GAGTTTTACGACCCGTCTGTGCCCGTGTCGCAGAAGTACGAGCTGGGCGCAGCGCTGTACATCGGCTGG
GCGGCCACCGCGCTGCTCATGGTAGGCGGCTGCCTCTTGTGCTGCGGCGCCTGGGTCTGCACCGGCCGT
CCCGACCTCAGCTTCCCCGTGAAGTACTCAGCGCCGCGGCGGCCCACGGCCACCGGCGACTACGACAAG
AAGAACTACGTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_003277
Insert Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003277.3
RefSeq Size 1720 bp
RefSeq ORF 912 bp
Locus ID 7122
UniProt ID O00501
Cytogenetics 22q11.21
Domains PMP22_Claudin
Protein Families Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
MW 31.6 kDa
Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets. Mutations in this gene have been found in patients with velocardiofacial syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2018]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1, and encodes a protein (isoform 1) of 303 aa. A common SNP (rs885985) encodes a stop codon in the 5' coding region and thus, for some haplotypes, translation is predicted to initiate from a downstream AUG to produce a protein of 218 aa (isoform 2).
Write Your Own Review
You're reviewing:Claudin 5 (CLDN5) (NM_003277) Human Untagged Clone
Your Rating
SKU Description Size Price
RC207122 CLDN5 (Myc-DDK-tagged)-Human claudin 5 (CLDN5), transcript variant 2 10 ug
$300.00
RC207122L1 Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC207122L2 Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 2, mGFP tagged 10 ug
$600.00
RC207122L3 Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC207122L4 Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 2, mGFP tagged 10 ug
$600.00
RC229148 CLDN5 (Myc-DDK-tagged)-Human claudin 5 (CLDN5), transcript variant 2 10 ug
$330.00
RG207122 CLDN5 (tGFP-tagged) - Human claudin 5 (CLDN5), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC118095 CLDN5 (untagged)-Human claudin 5 (CLDN5), transcript variant 2 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.