HOPX (NM_032495) Human Untagged Clone

SKU
SC327724
HOPX (untagged)-Human HOP homeobox (HOPX) transcript variant 1
$165.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HOPX
Synonyms CAMEO; HOD; HOP; LAGY; NECC1; OB1; SMAP31; TOTO
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_032495, the custom clone sequence may differ by one or more nucleotides
ATGCTCATTTTCCTGGGCTGTTACAGAAGAAGACTGGAAGAGCGCGCAGGGACCATGTCG
GCGGAGACCGCGAGCGGCCCCACAGAGGACCAGGTGGAAATCCTGGAGTACAACTTCAAC
AAGGTCGACAAGCACCCGGATTCCACCACGCTGTGCCTCATCGCGGCCGAGGCAGGCCTT
TCCGAGGAGGAGACCCAGAAATGGTTTAAGCAGCGCCTGGCAAAGTGGCGGCGCTCAGAA
GGCCTGCCCTCAGAGTGCAGATCCGTCACAGAC
Restriction Sites Please inquire
ACCN NM_032495
Insert Size 1552 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032495.5, NP_115884.4
RefSeq Size 1552 bp
RefSeq ORF 276 bp
Locus ID 84525
UniProt ID Q9BPY8
Cytogenetics 4q12
Domains homeobox
Protein Families Transcription Factors
Summary The protein encoded by this gene is a homeodomain protein that lacks certain conserved residues required for DNA binding. It was reported that choriocarcinoma cell lines and tissues failed to express this gene, which suggested the possible involvement of this gene in malignant conversion of placental trophoblasts. Studies in mice suggest that this protein may interact with serum response factor (SRF) and modulate SRF-dependent cardiac-specific gene expression and cardiac development. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (1) encodes isoform a.
Write Your Own Review
You're reviewing:HOPX (NM_032495) Human Untagged Clone
Your Rating
SKU Description Size Price
RC222859 HOPX (Myc-DDK-tagged)-Human HOP homeobox (HOPX), transcript variant 1 10 ug
$150.00
RC222859L1 Lenti ORF clone of Human HOP homeobox (HOPX), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC222859L2 Lenti ORF clone of Human HOP homeobox (HOPX), transcript variant 1, mGFP tagged 10 ug
$450.00
RC222859L3 Lenti ORF clone of Human HOP homeobox (HOPX), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC222859L4 Lenti ORF clone of Human HOP homeobox (HOPX), transcript variant 1, mGFP tagged 10 ug
$450.00
RG222859 HOPX (tGFP-tagged) - Human HOP homeobox (HOPX), transcript variant 1 10 ug
$489.00
SC104614 HOPX (untagged)-Human HOP homeobox (HOPX), transcript variant 1 10 ug
$150.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.