SUMF2 (NM_001146333) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | SUMF2 |
Synonyms | pFGE |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001146333, the custom clone sequence may differ by one or more nucleotides
ATGTTTGGATGGAGCTTTGTCTTTGAGGACTTTGTCTCTGATGAGCTGAGAAACAAAGCC ACCCAGCCAATGAAGTCTGTACTCTGGTGGCTTCCAGTGGAAAAGGCATTTTGGAGGCAG CCTGCAGGTCCTGGCTCTGGCATCCGAGAGAGACTGGAGCACCCAGTGTTACACGTGAGC TGGAATGACGCCCGTGCCTACTGTGCTTGGCGGGGAAAACGACTGCCCACGGAGGAAGAG TGGGAGTTTGCCGCCCGAGGGGGCTTGAAGGGTCAAGTTTACCCATGGGGGAACTGGTTC CAGCCAAACCGCACCAACCTGTGGCAGGGAAAGTTCCCCAAGGGAGACAAAGCTGAGGAT GGCTTCCATGGAGTCTCCCCAGTGAATGCTTTCCCCGCCCAGAACAACTACGGGCTCTAT GACCTCCTGGGGAACGTGTGGGAGTGGACAGCATCACCGTACCAGGCTGCTGAGCAGGAC ATGCGCGTCCTCCGGGGGGCATCCTGGATCGACACAGCTGATGGCTCTGCCAATCACCGG GCCCGGGTCACCACCAGGATGGGCAACACTCCAGATTCAGCCTCAGACAACCTCGGTTTC CGCTGTGCTGCAGACGCAGGCCGGCCGCCAGGGGAGCTG |
Restriction Sites | Please inquire |
ACCN | NM_001146333 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001146333.1, NP_001139805.1 |
RefSeq Size | 1907 bp |
RefSeq ORF | 642 bp |
Locus ID | 25870 |
UniProt ID | Q8NBJ7 |
Cytogenetics | 7p11.2 |
Summary | The catalytic sites of sulfatases are only active if they contain a unique amino acid, C-alpha-formylglycine (FGly). The FGly residue is posttranslationally generated from a cysteine by enzymes with FGly-generating activity. The gene described in this record is a member of the sulfatase-modifying factor family and encodes a protein with a DUF323 domain that localizes to the lumen of the endoplasmic reticulum. This protein has low levels of FGly-generating activity but can heterodimerize with another family member - a protein with high levels of FGly-generating activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (7) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 2. The encoded isoform (g) is shorter than isoform b. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC228764 | SUMF2 (Myc-DDK-tagged)-Human sulfatase modifying factor 2 (SUMF2), transcript variant 7 | 10 ug |
$330.00
|
|
RC228764L3 | Lenti-ORF clone of SUMF2 (Myc-DDK-tagged)-Human sulfatase modifying factor 2 (SUMF2), transcript variant 7 | 10 ug |
$630.00
|
|
RC228764L4 | Lenti-ORF clone of SUMF2 (mGFP-tagged)-Human sulfatase modifying factor 2 (SUMF2), transcript variant 7 | 10 ug |
$630.00
|
|
RG228764 | SUMF2 (tGFP-tagged) - Human sulfatase modifying factor 2 (SUMF2), transcript variant 7 | 10 ug |
$530.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.